Bienvenue cher visiteur
Veuillez vous inscrire ou vous connecter

  Nom d’utilisateur:   Mot de passe:   
Index  FAQ  Rechercher  Membres  Groupes  Profil  S’enregistrer
 Se connecter pour vérifier ses messages privés
  Detection de legionella par cytometrie sur phase solide?
Sauter vers:    
  Poster un nouveau sujet   Répondre au sujet medmatiq Index du Forum » Médecine » 2èm cycle " 3 , 4 et 5 ème année " » Microbiologie - Maladies infectieuses
    
Auteur Message
biouided
New
New

Hors ligne

Inscrit le: 12 Déc 2008
Messages: 9
Féminin Bélier (21mar-19avr)
Point(s): 9
Moyenne de points: 1,00
MessagePosté le: Ven 12 Déc - 07:24 (2008) Répondre en citant

on dit que les techniques de detection des legionella par immunofluorescent (IF) ou l'hybridation in situ fluorescente (FISH) avec la détection par microscopie d'epifluorescence ne peuvent pas être appliquées à la détection des événements rares.
que ce qu'on veut dire là par enenements rar ????????????????


Publicité





MessagePosté le: Ven 12 Déc - 07:24 (2008)

PublicitéSupprimer les publicités ?
biouided
New
New

Hors ligne

Inscrit le: 12 Déc 2008
Messages: 9
Féminin Bélier (21mar-19avr)
Point(s): 9
Moyenne de points: 1,00
MessagePosté le: Lun 15 Déc - 06:34 (2008) Répondre en citant

 Expression of Bacillus thuringiensis (B.t.) insecticidal crystal protein gene in transgenic potato
 

Abstract. The crystal proteins, d-endotoxins, of Bacillus thuringiensis are specifically lethal to Lepidopteran insects. A truncated B.t. toxin gene, cryIA(a), encoding an insecticidal crystal protein (ICP) directed by the cauliflower mosaic virus 35S promoter was transferred to potato plants by an Agrobacterium-mediated transformation system. The integration of the cryIA(a) gene into potato genome was determined by Southern blot analysis and polymerase chain reaction (PCR). The copy number of the integrated gene was estimated by inverse polymerase chain reaction (IPCR). The cryIA(a) RNA transcripts in transgenic potato plants were demonstrated by Northern blot analysis. Seven out of thirty transgenic plants expressed the cryIA(a) gene. Those transgenic plants containing multiple transgene copies did not express cryIA(a) gene. Nevertheless, transgenic potato plants grown in the greenhouse contained 7_52 ng ICP per gram fresh leaf.
 

 

Abbreviations: ICP, insecticidal crystal protein; IPCR, inverse polymerase chain reaction; PCR, polymerase chain reaction; PSC, potato suspension cultures; RB, T-DNA right border; LB, T-DNA left border; NPTII, neomycin phosphotransferase II.
 
 
 Introduction
 

The potato (Solanum tuberosum L.) is one of the major crops in agricultural production. Current efforts to develop insect-resistant crops through biotechnology are based primarily on transforming plants with a single gene encoding insecticidal enzyme or toxin. The most widely used genes in this approach are the d-endotoxin gene of Bacillus thuringiensis, a sporeforming, gram-positive bacterium. The insecticidal crystal protein (ICP) from the B. thuringiensis var. kustaki is a specific toxin for lepidopteran insects yet exhibits no toxicity toward humans, other vertebrates, or beneficial insects (Delannay et al., 1989). Formulated bacterial products have been used as insecticides for a long time. However, practical usages of such microbial products are limited because of their relatively high cost and poor persistence under field conditions, resulting in a need for multiple applications (Sneh et al., 1983).
 

Lepidopteran-active ICPs are protoxins of MW. 130_160 kDa. These protoxins emerge when exposed to an alkaline medium (pH 9_12), such as that found in the insect midgut. These protoxins are proteolytically cleaved into smaller, active forms (MW 60_70 kDa) derived from
  the N-terminal half of the protein (Hofte et al., 1989). Although the mode of toxin action is largely unknown, it is assumed to bind specific proteins on the membrane of the insect gut (Hofmann et al., 1988).
 

The B.t. toxin cryIA gene of B. thuringiensis has been engineered and transferred into several plant species to yield resistance against certain lepidopteran insects. The truncated genes, which produce insecticidally active protein, have been expressed in potato (Adang et al., 1993; Perlak et al., 1993), tomato (Delannay et al., 1989), tobacco (Barton et al., 1987; Fischhoff et al., 1987; Vaeck et al., 1987), cotton (Perlak et al., 1990), corn (Koziel et al., 1993), and rice (Fujimoto et al., 1993). The use of a native d-endotoxin coding region, which has a high A-T content, appears to lead to an abnormally low expression in plants. Modifications of the coding region sequence to increase the G-C content of the native gene resulted in a dramatic increase in the expression of the insecticidal protein (Perlak et al., 1991).
 

As a first step toward the development of an insect resistant potato, attempts were made to transfer the truncated cryIA(a) gene directed by the cauliflower mosaic virus 35S promoter into potato plants through Agrobacterium-mediated transformation. These transgenic potato plants could provide alternatives to hazardous synthetic chemical insecticides for controlling lepidopteran pests.
 
 
 4Corresponding author.
 
 
 

--------------------------------------------------------------------------------
             
 
   Botanical Bulletin of Academia Sinica, Vol. 37, 1996
 
 
 Materials and Methods
 

Plasmid Construction
 

The 2 kb truncated cryIA(a) gene was isolated from the plasmid DNA of B. thuringiensis var. karstaki by PCR (Schnepf et al., 1985). Two sequences in the B.t. coding region were chosen to amplify a 2 kb fragment within the gene. These two sequences were: 5' primer (TGGAGGTAACTTATGGATAACAATCCG) and the 3' primer (TCACTCAACTAAATTGGATACTTGATCA). The 5' and 3' primers include a plant translation initiation site (ATG) and a stop codon (UGA), respectively. PCR was carried out in a 50-ml reaction mixture containing 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.25 mM MgCl2, 0.01% (W/V) gelatin, 0.1% (W/V) Triton X100, 0.2 mM of each deoxynucleoside triphosphate (dATP, dCTP, dGTP, dTTP), and 2.5 units of Taq DNA polymerase (Promega). The sample was preheated at 94°C for 1.5 min; annealed at 37°C for 2 min; and extended at 72°C for 5 min. This process was followed by 13 cycles of denaturation at 94 °C for 1 min; annealing at 40°C for 2 min; and extension at 72°C for 5 min. The PCR amplified 2 kb DNA fragment containing the essential region, the N-terminal region, of the B.t. gene was then modified to blunt end with Klenow fragment before ligation with pTZ19U plasmid at the SmaI site. The resulting clone U73 was then used as a source of the B.t. gene. The B.t. gene HincII-SstI (SstI partial digestion) restriction fragment from the U73 was subcloned into the SmaI and SstI site of the plant expression vector pBI121 (Jefferson, 1987) in which the GUS gene was deleted to create the new plasmid pBT121A (Figure 1). The pBT121A plasmid contained NPTII coding sequence for transformant selection in a kanamycin medium.
 

Transgenic Potato Plants
 

Triparental mating was used to mobilize pBT121A constructs into Agrobacterium tumefaciens C58C1 harboring
  helper plasmid pGV2260 (which provides vir functions) (kindly provided by Dr. Marc Van Montagu, Laboratorium voor Genetica, Belgium). Potato (Solanum tuberosum L.) cv. ADH69 microtubers grown in vitro were transformed with Agrobacteria, and kanamycin-resistant plants were regenerated (Chang and Chan, 1991).
 

DNA Analysis
 

DNA was isolated from leaves of putative transgenic plants according to the CTAB method (Hurray and Thompson, 1980). DNA blot analysis was performed as described by Maniatis et al. (1982). About 0.8 kb of the cryIA(a) DNA was used as probe generated from the EcoRI digestion of pBT121A and labeled with [a-32P]dCTP using the random primer method (Feinberg and Vogelstein, 1983). To determine the copy number of transgenes integrated into transgenic plants, inverse polymerase chain reaction (IPCR) of genomic DNA for NPTII DNA was performed according to the method previously described (Does et al., 1991).
 

cryIA(a) RNA Analysis
 

Total RNA was purified from leaves according to the method of Belanger et al. (1986). RNA blot analysis was performed as described by Thomas (1983). The EcoRI fragment of pBT121A containing the cryIA(a) DNA was used as a probe.
 

NPTII Dot Blot Assay
 

The NPTII activity in the putative transgenic plants was assayed for at least three replicates using the method described by Chan et al. (1993).
 

ICP Protein Determination
 

Truncated ICP was used as a standard on the immunoblot. This protein was produced under the influence of the lac promoter on pUN4 (Chen, 1992). Polyclonal rabbit antibodies specific for the B. thuringiensis subsp. kurstaki ICP were used to determine the quantity of ICP accumulated in the crude extract of leaf samples. Extracts were made by grinding leaf tissue in liquid nitrogen followed by addition of extraction buffer (50 mM Na2CO3, pH 9.5, 100 mM NaCl, 0.05% Triton X-100, 0.05% Tween-20, 1 mM phenylmethyl sulfonyl fluoride (PMSF), and 1 mM leupeptin). Protein contents were determined using the Bradford method (Bradford, 1976). Western blot analysis was done as described by Yu et al. (1991). Protein dot-blot analysis was performed as described previously (Chan et al., 1994).
 

Results
 

Introduction of a Truncated cryIA(a) Gene into Potato Plants
 

Three to four month old microtubers grown in vitro were inoculated with Agrobacterium tumefaciens C58C1 (pGV2260 + pBT121A) and then cultured on a kanamy
 
 
  
 
 Figure 1. Map of the binary vector pBT121A containing the 35S/cryIA(a) chimeric gene.
 
 
 

--------------------------------------------------------------------------------
                       
 
 Chan et al. — cryIA(a) gene expression in transgenic potato
   
 
 cin selection medium. Thirty putative transformants out of the one-hundred treated microtubers were obtained and designated as P1 to P30. Southern blot analysis of HindIII digested genomic DNA from leaves of three putative transformants (P5, P7, and P10) were performed in order to demonstrate the integration of 35S/cryIA(a) in the genome of ADH69 (Figure 2). One band of approximately 11 kb appeared for P5 (Figure 2A, lane 2), 14 kb for P7 (Figure 2A, lane 3), and 6.5 kb for P10 (Figure 2A, lane 4). The probe did not hybridize with the DNA of the non-transformed control (Figure 2A, lane 5). These results indicate that the cryIA(a) DNA was integrated into the genome of the transformants. All other putative transformants were evaluated to determine whether the chimeric gene was integrated into the genome and to determine its copy number by IPCR analysis. IPCR analysis of genomic DNA using primers for amplifying the NPTII gene showed that most of the transformants—except P13, P16, P22, and P23— contain one copy of NPTII genes. No amplified DNA fragment was obtained for the non-transformant or for one putative transformant, P4 (data not shown). It is possible that P4 might be a non-transformant escaped from the selection medium. P13 and P23 showed two copies of the chimeric gene (Figure 2B) while P16 and P22 showed three and four copies, respectively (Figure 2B). When using DNA samples of the remaining 29 transgenic potatoes as template and priming them with the 3' and 5' ends of the cryIA(a) gene for PCR analysis, only 24 transformants had the amplified fragment (data not shown).
  Expression of 35S/cryIA(a)/nos in Potato Variety ADH69
 

To examine the expression of the cryIA(a) gene in the 24 transgenic potato plants, total RNA isolated from leaves was hybridized with the coding region of the truncated cryIA(a) gene. The results indicated that cryIA(a) RNA transcripts were present in leaves of seven transgenic potato plants and the level of expression varied (Figure 3). No RNA transcript could be detected in P16. The remaining 17 transformants, including P13, P22, and P23, did not hybridize with the probe (data not shown). The NPTII transcript could be detected when these blots were rehybridized with a NPTII probe, indicating that the total RNA was not degraded (data not shown). In addition, staining of ribosomal RNA (rRNA) with ethidium bromide showed that the amount of total RNA applied was approximately the same among the different transgenic plants (Figure 3). The results of Northern blot analysis imply that cryIA(a) RNA can not be expressed well in those transgenic plants containing multiple transgene copies (P13, P16, P22, and P23); however, the NPTII RNA transcript can be detected in these transformants.
 

Expression of NPTII in the Transgenic Potato Plants
 

Plasmid pBT121A containing the NPTII-coding region was driven by the nopaline synthase promoter. Accordingly, selection for plants carrying the foreign genes was achieved using media containing kanamycin. To determine if the NPTII mRNA resulted in the synthesis of
 
 
 
 A
 B
   
  
 
   
 
 
 Figure 2. (A) DNA blot analysis for detection of cryIA(a) DNA in the putative transgenic potato plants. Five µg of DNA digested with HindIII were loaded into each well. The EcoRI 0.8 kb fragment from pBT121A containing cryIA(a) DNA was used as a probe. Lane 1, lDNA cut with HindIII; Lanes 2_4, independent transgenic plant, P5, P7, P10, respectively. Lane 5, DNA from a non-transformed control plant. (B) Analysis of the IPCRs for 5 transformed plants (P5, P13, P16, P22, P23) and a non-transformed control plant (CK). One µg of plant DNA was used per reaction. Lane 1, fX174 marker; Lanes 2_3, plasmid pBT121A as the positive control (PK). M: MstII; S: SstII.
 
 
 

--------------------------------------------------------------------------------
               
 
   Botanical Bulletin of Academia Sinica, Vol. 37, 1996
 
  
  detectable in six transformants under this condition. P10 transformant produced the highest levels of CryIA(a) protein compared to the others listed in the Table 1. The yield of the CryIA(a) protein was estimated to be about 52 ng per g of fresh leaf tissue in P10, which was about six times higher than plant P17. P16, which contained the cryIA(a) gene but had no protein according to immunoblot analysis, produced no detectable level of ICP in the plant (Table 1). No cross reaction could be observed with a non-transformed control plant.
 
 
 Figure 3. Northern blot of total RNA from transgenic potato leaves hybridized with the cryIA(a) DNA fragment. Ethidium bromide staining of gel prior to blotting showed that RNA was intact as judged by ribosomal RNA (rRNA) bands and that each lane contained an approximately equal amount of RNA. B.t. = cryIA(a).
  Table 1. Comparison of cryIA(a) ICP levels in independent transgenic potatoes.
 

ICP line ng ICP/g fresh weight
 

(mean ± SEM)
 

P5 41 ± 5
 

P7 39 ± 6
 

P10 52 ± 7
 

P12 32 ± 8
 

P14 28 ± 7
 

P16 nd
 

P17 7 ± 4
 

P21 11 ± 3
 

CK 2 ± 1
 

*Values were obtained by dot-blot and densitometry assay and converted to ng ICP per gram fresh weight. Leaf samples were obtained from nodes 1 to 5. Values shown are average of 4 samples. nd: not detectable; CK: non-transformant.
 
 
  
 Figure 4. Neomycin phosphotransferase II dot blot assay. Thirty mg protein extracts from leaves and extracts of 5 randomly selected transgenic potato plants were reacted with [g-32P]-ATP, dot blotted on Whatmann P81 papers and autoradiographed. Row A: reactions with kanamycin. Row B: reaction without kanamycin. Lane 1, protein extracts from non-transformed control plant (CK); Lanes 2_5, protein extracts from transgenic potato, respectively.
 
 
   
 
 NPTII protein, protein was extracted from leaves of transgenic plants. NPTII activity was further monitored in 15 randomly chosen transgenic plants. All of the 15 transgenic plants demonstrated NPTII activity. No activity was observed in the non-transformed control group (Figure 4). These results clearly demonstrated that NPTII protein can be transcribed well in these transgenic plants.
 

Expression of CryIA(a) Protein in Transgenic Potato Plants
 

To determine the expression of CryIA(a) protein, immunoblot analysis was performed with extracts obtained from leaves of transgenic potato plants to ascertain levels of the CryIA(a) protein accumulated in transgenic plants. No signal, except the purified CryIA(a) protein from E. coli (the positive control), was detected for all transformants. The lack of signal could be attributable to a low level expression of the cryIA(a) gene in transgenic plants. Therefore, a high protein concentration (500 mg) was applied to the dot-blot apparatus and subjected to immunoblot analysis. In addition, we chose six transgenic plants in which cryIA(a) mRNA expression could be achieved and P16, no cryIA(a) mRNA transcript, to be the materials As shown in Figure 5, the CryIA(a) protein was
 
 
  Figure 5. ICP protein dot blot assay. Protein extracts (500 mg) from approximately one gram of transgenic potato leaf tissue were dot blotted on nitrocellulose membrane, and the ICP protein was detected by an alkaline phosphatase conjugated goat anti-rabbit antibody after the binding of an antibody against ICP.
 
 
 

--------------------------------------------------------------------------------
             
 
 Chan et al. — cryIA(a) gene expression in transgenic potato
   
 
 Discussion
 

The 35S/cryIA(a)/nos chimeric gene was transferred into and expressed in potato plants. Twenty-nine transformants which survived on selection medium, expressed the NPTII activity (Figure 4). Using DNA samples of the 29 transgenic plants as templates to amplify the cryIA(a) gene fragment, five transformants showed no evidence of amplification. Although the possible cause of this phenomenon is still unclear, it is possible that the gene might be lost due to the replication and repair of transgenes prior to integration (Gheysen et al., 1991).
 

Most transgenic plants carrying the cryIA(a) gene did not express it with the exception of seven transformants (Table 1). The correlation between gene copy number and its expression in transformants has been reported to be positive (Gendloff et al., 1990; Hobbs et al., 1992), indeterminate (Dean et al., 1989), or negative (Hobbs et al., 1990, 1992). The results in this study indicated that transformants with higher ICP activity all had single copy while those transformants with no ICP activity (like P13, P16, P22, and P23) all had multiple copies of the T-DNA containing cryIA(a) gene (Figure 2B). We do not know what causes this phenomenon. In this experiment the rRNA was used as an internal control and a similar amount of RNA was loaded into each well. This negative correlation suggested a possibility that the lack of cryIA(a) mRNA transcripts might result from epigenetic silencing of gene expression by induction of repeated DNA sequence. A similar observation was reported earlier by van der Krol et al. (1990) and Napoli et al. (1990), who showed that transformation of additional homologous genes caused a gene-specific collapse in expression. The mechanism of co-suppression by transgenes may involve interference of RNA strands with the transcription process itself or DNA methylation of the endogenous gene. DNA methylation has been shown to be a mechanism for inactivation of chimeric transgenes (Hobbs et al., 1990; Matzke et al., 1989) and the demethylating agent 5-azacytidine has been used to reactivate silent transgenes (Bochardt et al., 1992). In addition, treatment of Agrobacterium with 5-azacytidine was efficient in increasing transformation frequencies (Palmgren et al., 1993). The suppression of cryIA(a) caused by these processes is being studied in our laboratory.
 

Among the seven transformants which expressed cryIA(a) gene, the levels of mRNA transcripts varied. The variation in transgene expression might be the result of a position effect in the genome. Low levels of cryIA(a) gene expression in plants might also be attributable to mRNA instability as suggested by Murray et al. (1991). A similar construct, 35S/cryIA(a)/nos, was involved in their studies. This RNA instability might also be due to an incomplete functioning of a polyadenylation signal. Furthermore, plant codon usage, in general, prefer G + C content in the codon position III (Murray et al., 1989), but the truncated cryIA(a) gene used in our study has a high A + T content, which may lead to low gene expression. However, a major
  block to cryIA(a) gene expression in plants might be related to translation, which in turn effects the accumulation of cryIA(a) mRNA. Several lines of evidence show that insect-resistant plants containing the modified cryIA(b) have higher amounts of RNA than those with the truncated wild type gene (Fujimoto et al., 1993; Perlak et al., 1991). Those modified ICPs are more abundant in the transgenic plants.
 

Transgenic plants expressing insecticidal crystal genes are a powerful tool in an integrated pest management program. Several strategies have been proposed to increase insect-resistance in the field. The first involves the use of a tissue-specific, chemically-responsive (Williams et al., 1992), or wound-inducible promoter for B.t. expression. The second strategy is to modify the B.t. coding usage leading to a higher expression in the plant. The third, and final, strategy for enhancing the insect-resistant effect is to induce expressions of various B.t. genes in the same plant. Although in our study the level of CryIA(a) in transgenic potato plants was relatively low, it still amounted to 7_52 ng/g of fresh weight tissue. Several studies have also shown other transgenic plants expressing the truncated CryIA(b) at a level similar to our transgenic potatoes (Barton et al., 1987; Fischhoff et al., 1987; Vaeck et al., 1987). Since the LC50 (50% insect lethal of ICP concentration) for lepidopteran pests is about 25_40 ng/g (Vaeck et al., 1987), it is highly possible that transgenic potato plants will have significant defences against lepidopteran pests with further improvement in gene expression.


biouided
New
New

Hors ligne

Inscrit le: 12 Déc 2008
Messages: 9
Féminin Bélier (21mar-19avr)
Point(s): 9
Moyenne de points: 1,00
MessagePosté le: Lun 15 Déc - 07:42 (2008) Répondre en citant

GENERAL CHARACTERISTICS
The leading biorational pesticide, Bacillus thuringiensis, is a ubiquitous gram-positive, spore-forming bacterium that forms a parasporal crystal during the stationary phase of its growth cycle. B. thuringiensis was initially characterized as an insect pathogen, and its insecticidal activity was attributed largely or completely (depending on the insect) to the parasporal crystals. This observation led to the development of bioinsecticides based on B. thuringiensis for the control of certain insect species among the orders Lepidoptera, Diptera, and Coleoptera (for a review, see reference 33). There are more recent reports of B. thuringiensis isolates active against other insect orders (Hymenoptera, Homoptera, Orthoptera, and allophaga) and against nematodes, mites, and protozoa (109, 110). B. thuringiensis is already a useful alternative or supplement to synthetic chemical pesticide application in commercial agriculture, forest management, and mosquito control. It is also a key source of genes for transgenic expression to provide pest resistance in plants. In 1989, Ho¨fte and Whiteley reviewed the known cry genes and proposed a systematic nomenclature for them (164). Since then, the number of sequenced crystal protein genes (encoding Cry and Cyt proteins) has grown from 14 to well more than 100. In our accompanying work (79), we propose a revised
nomenclature to accommodate this wealth of new sequence data. The present work reviews the extensive progress during the past decade in determining the gene expression, structure, and mechanism of action for these classes of proteins. The proposed revised nomenclature will be used throughout. ECOLOGY AND PREVALENCE
B. thuringiensis seems to be indigenous to many environments (36, 65, 255). Strains have been isolated worldwide from many habitats, including soil (59, 88, 154, 255, 354), insects (59), stored-product dust (54, 65, 87, 267), and deciduous and coniferous leaves (175, 354). Isolation typically involves heat treatment to select for spores, sometimes with an acetate enrichment step (382) or antibiotic selection (89). The diversity in flagellar H-antigen agglutination reactions is one indication of the enormous genetic diversity among B. thuringiensis isolates.
The Pasteur Institute has catalogued 55 different flagellar serotypes and eight nonflagellated biotypes (202, 205). There is considerable evidence that B. thuringiensis and Bacillus cereus should be considered a single species. Classical biochemical and morphological methods of classifying bacteria have consistently failed to distinguish B. thuringiensis from B. cereus (31, 139, 177, 229, 305). Modern molecular methods— including chromosomal DNA hybridization (179), phospholipid and fatty acid analysis (40, 178), 16S rRNA sequence  comparison (20, 318), amplified fragment length polymorphism analysis (181), and genomic restriction digest analysis (56, 57)—likewise support the single-species hypothesis. An attempt to distinguish B. thuringiensis isolates from B. cereus by analysis of a 16S rRNA variable region largely failed, yielding as many false positives and negatives as accurate identifications (373). The production of the parasporal crystal, the defining quality of B. thuringiensis, is too narrow a criterion for taxonomic purposes (237). Indeed, some B. cereus strains hybridize to cry1A-specific probes (56). Although we will employ the official nomenclature with two species names for these organisms, it is perhaps best to think of them as members of B. cereus sensu lato. The remarkable diversity of B. thuringiensis strains and toxins is due at least in part to a high degree of genetic plasticity. Most B. thuringiensis toxin genes appear to reside on plasmids (138), often as parts of composite structures that include mobile genetic elements (195, 218). Many cry gene-containing plasmids appear to be conjugative in nature (137). B. thuringiensis has developed a fascinating array of molecular
mechanisms to produce large amounts of pesticidal toxins during the stationary phase of growth (8, 30). One can only speculate about the ecological value to the bacterium of using several cry gene expression systems. However, coexpression of multiple toxins is likely to increase the host range of a given strain or of a population exchanging toxin genes. One report
has suggested plasmid transfer between different B. thuringiensis strains during growth within an insect (170). We are not aware of any critical experiments directed towards understanding bacterial toxin gene expression within the gut of a susceptible pest. Persistence of B. thuringiensis spores in the laboratory, greenhouse, and field or forest environment has been reasonably well studied (299, 403, 405). B. thuringiensis spores can survive for several years after spray applications (6), although rapid declines in population and toxicity have been noted.
Methods of detection have generally been limited to spore counts.
Meadows (266) has analyzed three prevailing hypothetical niches of B. thuringiensis in the environment: as an entomopathogen, as a phylloplane inhabitant, and as a soil microorganism.
Available data are still insufficient to choose among these and other possibilities, although B. thuringiensis seems to have been more readily isolated from insect cadavers or storedproduct
dusts than from soil (36, 65). It is also noteworthy that B. thuringiensis and B. cereus are able to multiply in the insect hemocoel and to provoke septicemia (156, 157, 358). Early work recognized the presence of a number of extracellular compounds that might contribute to virulence, including phospholipases (434), other heat-labile toxin activities (reviewed in
reference 332), and b-exotoxins (221). More recent characterization has shown that proteases (232), chitinases (356), and the secreted vegetative insecticidal proteins (VIPs) (108) (see
below) may contribute to virulence. B. cereus and B. thuringiensis also produce antibiotic compounds that have antifungal activity (357); one of these products can act to synergize crystal protein-induced intoxication of certain lepidopterans (253).
The Cry toxins are, therefore, the most prominent of a number of virulence factors allowing the development of the bacteria in dead or weakened insect larvae. Such data are at least suggestive that many strains of B. thuringiensis and some strains of B. cereus can be regarded as opportunistic insect pathogens. A more thorough understanding of the true ecological roles of B. thuringiensis would be of great importance, both for improving the reliability of risk assessment and for developing efficient methods for isolating novel B. thuringiensis strains containing useful d-endotoxin genes.
A number of pesticidal proteins unrelated to the Cry proteins are produced by some strains of B. thuringiensis during vegetative growth (108, 401). These VIPs do not form parasporal
crystal proteins and are apparently secreted from the cell. The VIPs are presently excluded from the Cry protein nomenclature because they are not crystal-forming proteins.
The term VIP is a misnomer in the sense that some B. thuringiensis Cry proteins are also produced during vegetative growth as well as during the stationary and sporulation phases, most notably Cry3Aa (see “cry gene expression”). The location of the vip genes in the B. thuringiensis genome has not been reported, although it would not be surprising to find them
residing on large plasmids that encode cry genes. The vip1A gene encodes a 100-kDa protein that is apparently processed from its N terminus to yield an ;80-kDa protein upon secretion. The 80-kDa Vip1A protein is reported to be toxic to western corn rootworm larvae in conjunction with the Vip2A protein, whose coding region is located immediately upstream (401). Interestingly, Vip1A shows sequence similarity to the protective antigen of the tripartite Bacillus anthracis  toxin (298).
The vip3A gene encodes an 88-kDa protein that is produced during vegetative growth but is not processed upon secretion. Genes encoding Vip3A-type proteins appear to be common among strains of B. thuringiensis and B. cereus (108). This protein is reported to exhibit toxicity towards a wide variety of lepidopteran insect pests, including Agrotis ipsilon, Spodoptera frugiperda, Spodoptera exigua, and Helicoverpa zea (108). When fed to susceptible insects at lethal concentrations, Vip3A causes gut paralysis and lysis of midgut epithelial cells: the physical manifestations of Vip3A intoxication resemble those of the Cry proteins (431).

GENETICS AND MOLECULAR BIOLOGY
The B. thuringiensis Genome
B. thuringiensis strains have a genome size of 2.4 to 5.7
million bp (56). Physical maps have been constructed for two
B. thuringiensis strains (57, 58). Comparison with B. cereus
chromosomal maps suggests that all of these chromosomes
have a similar organization in the half near the replication
origin while displaying greater variability in the terminal half
(57). Most B. thuringiensis isolates have several extrachromosomal
elements, some of them circular and others linear (56).
It has long been recognized that the proteins comprising the
parasporal crystal are generally encoded by large plasmids
(138). Sequences hybridizing to cry gene probes occur commonly
among B. thuringiensis chromosomes as well (58), although
it is unclear to what degree these chromosomal homologs
contribute to production of the crystal.
The Transposable Elements of B. thuringiensis
The B. thuringiensis species harbors a large variety of transposable
elements, including insertion sequences and transposons.
The general characteristics of these elements have
been extensively reviewed by Mahillon et al. (248). Here, the B.
thuringiensis transposable elements are described with regard
to their structural association with the cry genes.
The first studies on the structural organization of the cry1A
gene environment showed that genes of this type were flanked
by two sets of inverted repeated sequences (195, 218). Nucleotide
sequence analysis revealed that these repetitive elements
were insertion sequences that have been designated IS231 and
IS232 (219, 237). IS231 belongs to the IS4 family of insertion
sequences (315), and IS232 belongs to the IS21 family of insertion
sequences (268). Because these elements can transpose
(152, 268), it is likely that they provide mobility for the cry
genes with which they form typical composite transposons.
However, this hypothesis has not been tested experimentally.
Several IS231 variants have been isolated from various B.
thuringiensis strains (249, 314, 316) and have been detected in
representative strains from well more than half of the known B.
thuringiensis serovars (212). In B. thuringiensis subsp. israelensis,
an IS231 element (IS231W) is adjacent to the cry11Aa gene
(4, 316). Although IS231 elements are frequently associated
with cry genes, IS231-related DNA sequences have also been
found in strains of B. cereus (190, 212) and Bacillus mycoides
(212). In contrast, IS232 has a much smaller range among the organisms surveyed so far, appearing in only 7 of 61 B. thuringiensis
serovars (212).
The cry4A gene of the israelensis subspecies is flanked by two
repeated sequences in opposite orientations (45). These sequences,
designated IS240, display features characteristic of
insertion sequences (83). The IS240 transposase is homologous
to those of the insertion sequences belonging to the IS6 family.
IS240 is widely distributed in B. thuringiensis and is invariably
present in known dipteran-active strains (319). Related sequences
have also been detected in B. mycoides and B. cereus
(212). An IS240 variant has been found upstream of the cry11B
gene in the B. thuringiensis subsp. jegathesan (86) and from a
plasmid of the dipteran-active strain B. thuringiensis subsp.
fukuokaensis (103).
Insertion sequences have been found upstream of the cry1Ca
gene (351) and downstream of a cryptic cry2Ab gene (160).
These elements encode putative transposases that have significant
similarities with the transposase of the IS150 element
from Escherichia coli. These potential transposable elements of
B. thuringiensis consequently belong to the IS3 family of insertion
sequences.
The first transposable element identified in the genus Bacillus
was isolated from B. thuringiensis following its spontaneous
insertion into a conjugative plasmid transferred from Enterococcus
faecalis (217). The genetic and structural characteristics
of this transposable element fulfilled the criteria of a Tn element,
and it was designated Tn4430 (216). Its transposase is
homologous to those of the Tn3 family. In contrast to Tn3,
however, the site-specific recombinase that mediates Tn4430
cointegrate resolution is not a resolvase but an integrase (247).
Tn4430 is frequently found in the vicinity of genes of the cry1A
type in various lepidopteran-active strains (196, 218, 328).
However, Tn4430-like sequences have also been detected in
several strains of B. cereus (56).
A transposable element designated Tn5401 was isolated
from a coleopteran-active B. thuringiensis strain following its
spontaneous insertion into a recombinant plasmid (27). Although
nucleotide sequence analysis indicates that the structural
organization of Tn5401 is similar to that of Tn4430, the
transposases and the site-specific recombinases of these transposons
are only distantly related (27). Tn4430 and Tn5401 are
not known to coexist in any B. thuringiensis strain (27). In B.
thuringiensis subsp. tenebrionis, Tn5401 is located just downstream
of the cry3Aa gene (3). It is noteworthy that Tn5401 has
been successfully used to construct a transposon insertion library
in B. thuringiensis (251).
Two open reading frames encoding polypeptides homologous
to the transposase and to the resolvase of the Tn3 family
of transposons have been identified upstream of the cry16A
gene found in Clostridium bifermentans (23, 82). This observation suggests that a Tn element is structurally associated with
this cry gene.
Regarding the role of the transposable elements in B. thuringiensis,
it is postulated that they are involved in the amplification
of the cry genes in the bacterial cell, but this hypothesis
has not been clearly tested. A second possible role is one of
mediating the transfer of plasmids by a conduction process
involving the formation of cointegrate structures between selfconjugative
plasmids and chromosomal DNA or nonconjugative
plasmids. Indeed, conjugation experiments suggest that
Tn4430 mediates the transfer of nonconjugative plasmids by a
conduction process (147). Thus, a major adaptive function for
these transposable elements may be the horizontal dissemination
of genetic material, including cry genes, within the B.
cereus-B. thuringiensis species.
cry Gene Expression
A common characteristic of the cry genes is their expression
during the stationary phase. Their products generally accumulate
in the mother cell compartment to form a crystal inclusion
that can account for 20 to 30% of the dry weight of the sporulated
cells. The very high level of crystal protein synthesis in B.
thuringiensis and its coordination with the stationary phase are
controlled by a variety of mechanisms occurring at the transcriptional,
posttranscriptional, and posttranslational levels.
Agaisse and Lereclus (8) and Baum and Malvar (30) have
recently reviewed the regulation of cry gene expression in detail.
We present here a broad outline of these regulatory mechanisms.
Transcriptional Mechanisms
The cry genes have long been considered typical examples of
sporulation-specific genes. However, recent studies on the expression
of the cry3Aa gene have revealed that this assumption  is not always valid. It is therefore necessary to distinguish,
among the cry genes expressed during the stationary phase,
those that are dependent on sporulation from those that are
not.
Sporulation-dependent cry Gene Expression. Extensive
studies of the sporulation of B. subtilis have provided detailed
information on the complex mechanisms that temporally and
spatially control this differentiation process (for reviews, see
references 104 and 231). At the transcriptional level, the development
of sporulation is controlled by the successive activation
of sigma factors, which bind the core RNA polymerase
to direct the transcription from sporulation-specific promoters
(275). These factors are the primary sigma factor of vegetative
cells, sA, and five factors called sH, sF, sE, sG, and sK, which
appear in that order in a temporally regulated fashion during
development. The sA and sH factors are active in the predivisional
cell, sE and sK are active in the mother cell, and sF
and sG are active in the forespore.
The cry1Aa gene is a typical example of a sporulation-dependent cry gene expressed only in the mother cell compartment
of B. thuringiensis. Two transcription start sites have been
mapped (BtI and BtII), defining two overlapping, sequentially
activated promoters (417). BtI is active between about T2 and
T6 of sporulation and BtII is active from about T5 onwards
(where Tn is n hours after the end of the exponential phase).
Brown and Whiteley (52, 53) isolated two sigma factors, s35
and s28, that specifically direct transcription of cry1Aa from BtI
and BtII, respectively. In vitro transcription experiments have
also indicated that at least two other cry genes (cry1Ba and
cry2Aa) contain either BtI alone or BtI with BtII (52).
The genes encoding s35 and s28 have been cloned and sequenced
(1). Their deduced amino acid sequences show 88 and
85% identity with sE and sK of B. subtilis, respectively. B.
thuringiensis sE and sK mutants were constructed, and cry1Aa
gene expression was analyzed in these mutants (48). The results
indicated that these two sigma factors regulated expression
of a cry1Aa9-9lacZ transcriptional fusion in vivo. The sK
mutant produced about 50% less b-galactosidase than the
wild-type strain, whereas no b-galactosidase synthesis was obtained
in the sE mutant. The latter result was anticipated,
because sE controls sK synthesis.
Several cry gene promoters have been identified, and their
sequences have been previously determined (50, 51, 94, 428,
430). Consensus sequences for promoters recognized by B.
thuringiensis RNA polymerase containing sE or sK have been
deduced from alignment of the promoter regions of these
genes (8, 30). The results are that, in addition to the transcription
of cry1Aa, cry1Ba, and cry2Aa, the transcription of many
other cry genes (e.g., cry4Aa, cry4Ba, cry11Aa, cry15Aa, etc.) is
likely to be sE- or sK-dependent. Analysis of cry4Aa, cry4Ba,
and cry11Aa gene fusions in a B. thuringiensis sigE mutant
confirms that SigE is required for their expression during
sporulation (304). In addition, from a genetic analysis of B.
subtilis, Yoshisue et al. (430) reported that the expression of
cry4B is reduced in a spoIIID mutant strain, thus suggesting
that SpoIIID, a DNA-binding protein, positively regulates the
SigE-dependent transcription of cry4B. The cry18Aa gene isolated
from Bacillus popilliae is successively transcribed by sE
and sK forms of RNA polymerase from a single promoter
during sporulation (433).
The expression of all these cry genes is therefore considered
to be sporulation dependent. However, low-level transcription
of the cry4Aa, cry4Ba, and cry11Aa genes in B. thuringiensis has
been detected during the transition phase, beginning at about
T22 and lasting until the onset of sporulation (304, 429). This
expression may be due to the sH RNA polymerase, and it is
suggested that Spo0A represses this weak expression, specific
to the transition phase, when the cells enter the sporulation
phase (304).





Sporulation-independent cry gene expression. The cry3Aa
gene, isolated from the coleopteran-active B. thuringiensis var.
tenebrionis, was found to be expressed during vegetative
growth, although at a lesser extent than during the stationary
phase (95, 252, 339). Analysis of lacZ transcriptional fusions
and primer extension experiments indicates that the cry3Aa
promoter is weakly but significantly expressed during vegetative
growth, is activated from the end of exponential growth
until stage II of sporulation (about T3), and remains active
until stage IV of sporulation (about T7) (10, 324). The cry3Aa
promoter, although located unusually far upstream of the start
codon (position 2558), resembles promoters recognized by the
primary sigma factor of vegetative cells, sA (10). A similar
promoter was found 542 bp upstream of the start codon of the
cry3Bb gene (30). The expression of cry3Aa is not dependent
on sporulation-specific sigma factors either in B. subtilis (7) or
in B. thuringiensis (324). Moreover, cry3Aa expression is increased
and prolonged in mutant strains unable to initiate
sporulation (7, 213, 251, 324). The results indicate that cry3Aa
expression is activated by a non-sporulation-dependent mechanism
arising during the transition from exponential growth to
the stationary phase. The positive effect of mutations preventing
the initiation of sporulation suggests that there is an event
during sporulation (e.g., the disappearance of sA in the mother
cell) that turns off cry3Aa expression (7, 324).
Posttranscriptional Mechanisms
The stability of mRNA is an important contributor to the
high level of toxin production in B. thuringiensis. The half-life
of cry mRNA, about 10 min, is at least fivefold greater than the
half-life of an average bacterial mRNA (135).
Wong and Chang showed that the putative transcriptional
terminator of the cry1Aa gene (a stem-loop structure) acts as a
positive retroregulator (416). The fusion of a DNA fragment
carrying this terminator with the 39 end of heterologous genes
increases the half-life of their transcripts two- to threefold,
which in turn increases the expression of their gene products.
It has been demonstrated in other systems that the processive
activities of 39-59 exoribonucleases are impeded by 39 stemloop
structures (for a review, see reference 279). It is likely,
then, that the cry1Aa transcriptional terminator increases the
cry mRNA stability by protecting it from exonucleolytic degradation
from the 39 end. Similar terminator sequences, potentially
able to form stable stem-loop structures, are found
downstream from various cry genes and may contribute to their
high-level expression by stabilizing the transcripts. However,
alternative processes could determine the rate of mRNA degradation,
and the direct involvement of these sequences on
mRNA stability has not been tested by deleting them from a
cry gene and measuring stability of the message.
Between the cry3Aa promoter, located from positions 2560
to 2600, and the translational start codon is a region involved
at a posttranscriptional level with the accumulation of cry3Aa
mRNA as a stable transcript with a 59 end corresponding to
nucleotide position 2129 (10). Deletion of 60 bp extending
from nucleotide positions 2189 to 2129 has no detectable
effect on the expression level or on the position of the 59 end
of the transcript (10). It is likely, then, that the initial transcript,
begun hundreds of bases upstream, is processed posttranscriptionally.
Insertion of the cry3Aa 59 untranslated region (extending
from nucleotides 2129 to 212) between the B. subtilis xylA  promoter and a lacZ reporter gene increases about 10-fold
both the stability of the lacZ fusion mRNA and the production
of b-galactosidase (9). Deletion and mutation analysis indicate
that the sequence required for the stabilizing effect is a perfect
Shine-Dalgarno sequence (GAAAGGAGG) mapping at a position
between 2125 and 2117; this sequence has been designated
STAB-SD (9). The stability of the cry3Aa mRNA could
result from an interaction between the 39 end of 16S rRNA and
STAB-SD. The binding of a 30S ribosomal subunit to this
sequence may protect the mRNA against 59-39 ribonuclease
activity, resulting in a stable transcript with a 59 end at nucleotide
position 2129 (i.e., the limit of 30S subunit protection).
Potential STAB-SD sequences are also present in similar positions
upstream of the cry3Ba, cry3Bb, and cry3Ca genes (96,
200).
Posttranslational Mechanisms
The Cry proteins generally form crystalline inclusions in the
mother cell compartment. Depending on their protoxin composition,
the crystals have various forms: bipyramidal (Cry1),
cuboidal (Cry2), flat rectangular (Cry3A), irregular (Cry3B),
spherical (Cry4A and Cry4B), and rhomboidal (Cry11A). This
ability of the protoxins to crystallize may decrease their susceptibility
to premature proteolytic degradation. However, the
crystals have to be solubilized rapidly and efficiently in the gut
of insect larvae to become biologically active. The structure
and the solubility characteristics of a crystal presumably depend
on such factors as the secondary structure of the protoxin,
the energy of the disulfide bonds, and the presence of
additional B. thuringiensis-specific components.
Studies have shown that several cry1 genes cloned in E. coli
(129) or B. subtilis (344) were able to direct the synthesis of
biologically active inclusions, suggesting that the 130- to 140-
kDa Cry1 protoxins can spontaneously form crystals. It is generally
assumed that the cysteine-rich C-terminal half of the
Cry1 protoxins contributes to crystal structure through the
formation of disulfide bonds (39). A similar mechanism of
protein self-assembly may be responsible for the crystal formation
of other 130- to 140-kDa protoxins (e.g., Cry4, Cry5, and
Cry7). The cysteine-rich C-terminal region is absent from the
73-kDa Cry3A protoxins. This protein forms a flat, rectangular
crystal inclusion in which the polypeptides do not appear to be
linked by disulfide bridges (35). Because this protein is able to
form identical crystals in both B. thuringiensis and B. subtilis, it
is possible that specific host factors are not required for the
protein assembly. Analysis of the three-dimensional structure
of the Cry3A toxin revealed the presence of four intermolecular
salt bridges, which might participate in the formation of
the crystal inclusion (222).
Various studies performed with E. coli and B. thuringiensis
have demonstrated that crystallization of Cry2A (71 kDa) and
Cyt1A (27 kDa) requires the presence of accessory proteins
(for recent reviews, see references 8 and 30). These proteins
may act at a posttranslational level to stabilize the nascent
protoxin molecule and to facilitate crystallization. However,
the precise mechanism of their role in crystal formation has not
been determined.
Kostichka et al. (192) have reported that a Cry1Ia toxin
could be found in the supernatant of B. thuringiensis cultures as
a processed polypeptide of 60 kDa. The authors hypothesize
that Cry1Ia is an exported protein and therefore interacts with
the cellular protein export machinery. Such a characteristic,
together with the fact that this toxin is synthesized early in
sporulation (192), may have implications for the significance of
these toxins in the ecology of B. thuringiensis. Similarly, the Cry16Aa toxin of C. bifermentans seems to be secreted during
sporulation (23).
TOXIN STRUCTURE
To date, the structures of three crystal proteins—Cry3A
(222), Cry1Aa (148), and Cyt2A (223)—have been solved by
X-ray crystallography. An analysis in the accompanying review
demonstrates that Cry3A and Cry1Aa show about 36% amino
acid sequence identity (79). This similarity is reflected in their
three-dimensional structures; the corresponding domains can
virtually be superimposed. Cyt2A, however, shows less than
20% amino acid sequence identity with Cry1Aa and Cry3A,
and a similar alignment score would be obtained if the Cyt2A
sequence were randomized. Not surprisingly, the Cyt2A structure
is radically different from the other two structures. The
structures of Cry1Aa, Cry3A, and Cyt2A are compared in Fig. 1.
The Cyt toxins, unlike the Cry d-endotoxins, are able to lyse
a wide range of cell types in vitro (164). Cyt2A consists of a
single domain in which two outer layers of alpha-helix wrap
around a mixed beta-sheet. Cyt1A is believed to have a similar
structure.
Cry3A and Cry1Aa, in contrast to Cyt2A, both possess three
domains. Domain I consists of a bundle of seven antiparallel
a-helices in which helix 5 is encircled by the remaining helices.
Domain II consists of three antiparallel b-sheets joined in a
typical “Greek key” topology, arranged in a so-called b-prism
fold (330, 343). Domain III consists of two twisted, antiparallel
b-sheets forming a b-sandwich with a “jelly roll” topology.
 

Structural and Sequence Similarities among Toxins
Ho¨fte and Whiteley (164) drew attention to the five blocks
of amino acids conserved among most of the Cry toxins then
known. Complete amino acid sequence alignment of the Cry
proteins in our data set reveals the same five tracts, or conserved
blocks, in most of them (Fig. 2 and 3). Comparison of the carboxyl-terminal halves of sequences with more than
1,000 residues suggests the presence of three additional blocks
lying outside the active toxic core.
Figure 4 shows an unrooted phylogenetic tree, constructed
by an unweighted pair-group method using arithmetic averages
algorithm from the multiply aligned Cry and Cyt protein sequences.
Five sequence similarity groups are apparent, together
with a single outlying sequence (Cry15). The conserved
blocks are distributed in a fashion consistent with these similarity
groups. The group consisting of Cry1, Cry3, Cry4, Cry7 to
Cry10, Cry16, Cry17, Cry19, and Cry20 contains all five of the
core blocks. A second group consisting of Cry5, Cry12 to
Cry14, and Cry21 contains recognizable homologs of blocks 1,
2, 4, and 5. Block 1 shows more variability within this second
group of sequences than within the first. The proteins within
this second subgroup also possess a block 2 variant; block 2
sequences show greater sequence similarity within the two
groups than between them (Fig. 2). Block 3 is completely
absent from this second group of Cry proteins; an unrelated
sequence, highly conserved within the second subgroup but
absent from the first, lies between blocks 2 and 4. For both
groups, when a protein possesses the C-terminal extension,
blocks 6, 7, and 8 are invariably present (Fig. 2). Members of
a third sequence similarity group, composed of Cry2, Cry11,
and Cry18, possess block 1 and a truncated variant of the block
2 core (Fig. 2) but lack convincing homologs of the other
conserved blocks (215). An alternating arginine tract not otherwise
homologous to block 4 is found near the C terminus of
Cry11 and Cry18. A weak homolog of block 5 may also be
present among the proteins in this group, but its significance, if
any, is uncertain (Fig. 2). The other proteins in the data set—
Cyt1, Cyt2, Cry6, Cry15, and Cry22—have no recognizable
homologs to the conserved blocks seen in the three groups
noted above.
 

The conservation of blocks 1 through 5 is at least consistent
with the notion that the proteins within the first subgroup,
which includes Cry1 and Cry3, might adopt a similar threedomain
tertiary structure. It is possible, too, that the second
subgroup—Cry5, Cry12 to Cry14, and Cry21—could possess a
variation of the same structural theme. The degree of sequence
similarity found in the Cry2, Cry11, and Cry18 group of proteins
suggests that a fold similar to that in domain I of Cry3A
may be present. Indeed, the crystal structure of Cry2Aa, which
has been solved but not yet published (423a), confirms this
prediction. Somewhat more surprisingly, Cry2A also possesses
second and third domains strikingly similar to those of Cry3A,
despite the apparent absence of primary sequence homology
between the two proteins over this region.
Block 1 encompasses helix 5 of domain I. As mentioned
below (see “Structure-Function Interpretations”), this helix
has been implicated in pore formation, a role that might explain
its highly conserved nature. The central location of helix
5 within domain I also suggests an essential role in maintaining
the structural integrity of the helical bundle.
Block 2 includes helix 7 of domain I and the first b-strand of
domain II. These two structures comprise the region of contact
between the two domains. There are three structurally equivalent
salt bridges present between domain I and domain II in
Cry1Aa and Cry3A (148); the residues involved lie within block
2. These interactions could be important if domain I changes
its orientation relative to the rest of the molecule upon binding
of the toxin to its receptor. Alternatively, the salt bridges could
be responsible for maintaining the protein in a globular form
during solubilization and activation.
Blocks 3, 4, and 5 each lie on one of the three buried strands
within domain III. Block 3 contains the last b-strand of domain
II, a structure involved in interactions between domains I and
III. The central two arginines of block 4 may be involved in
intermolecular salt bridges affecting crystal or oligomeric aggregation
(148, 222). As Grochulski et al. have noted, however, the first and last arginines are solvent exposed (148). These
residues have been implicated in channel function (68, 336,
414).
An alternative way of looking at protein families is to examine
the relatedness of structural or functional segments independently
(47, 378). This type of analysis helped show a correlation
between domain II sequence features shared by
distantly related toxins and the cross-resistance profile of a
diamondback moth mutant (369).
Structure-Function Interpretations
The long hydrophobic and amphipathic helices of domain I
suggest that this domain might be responsible for the formation
of lytic pores in the intestinal epithelium of the target
organism, one of the proposed mechanisms of Cry toxin activity
(see “Mechanism of action”). Domain I bears many striking
similarities to the pore-forming or membrane-translocating domains
of several other bacterial protein toxins, including colicin
A, diphtheria toxin, and—to a lesser extent—Pseudomonas
exotoxin A (287). The pore-forming domain of colicin A consists
of two central alpha-helices (a8 and a9) surrounded by
eight antiparallel alpha-helices (288). Pore formation is believed
to involve insertion of the hydrophobic a8-a9 helical
hairpin into the membrane (101, 220). Similarly, diphtheria
toxin is believed to enter the membrane via a hydrophobic
helical hairpin following a pH-induced change in conformation
(432). By analogy to these mechanisms, an “umbrella” model
has been proposed, in which the Cry proteins also contain a
hydrophobic helical hairpin (a4-a5) that initiates pore formation
(222). Schwartz et al. (334) created disulfide bonds within
domain I and between domains I and II in order to restrict
intramolecular movements. Their results are consistent with
the model described above in which helices 4 and 5 insert into
the membrane while the rest of domain I flattens out on the
membrane surface in an umbrella-like molten globule state.
However, the lack of protein structural analysis in this work
leaves open the possibility that the disulfide bonds blocked the
ability of these mutant proteins to penetrate the membrane.
Similarly, little can be surmised as to the final structure of
the lytic pore; a structure involving amphipathic helices (with
the hydrophilic faces forming the lumen of the pore) seems the
most probable. Given, however, that most domain I helices are
largely amphipathic and theoretically long enough to span a
membrane, little can be concluded. Even helix 2, which is split
by a short nonhelical stretch, could traverse a membrane as
part of a channel. Comparison of the Cry3A domain I helices
with other known classes of amphipathic helices suggests that
many of the helices (in particular a1, a5, and a6) show features
characteristic of lytic peptides (378).
In contrast, Hodgman and Ellar (159) have proposed a
“penknife” model for pore formation. In this model, based on
the similarly named proposal for colicin A insertion (159), the
strongly hydrophobic helices a5 and a6, which are joined by a
loop at the top of the structure, open in a penknife fashion and
insert into the membrane. The remainder of the molecule
would remain at the membrane surface or on the receptor.
Both the umbrella and penknife models are reviewed and
illustrated by Knowles (185).
The surface-exposed loops at the apices of the three
b-sheets of domain II, because they show similarities to immunoglobin
antigen-binding sites, were initially put forward as
candidates for involvement in receptor binding. Site-directed
mutagenesis and segment swapping experiments, as described
under “Mechanism of action,” have provided evidence in support
of this model. It is interesting to note that domain II has
FIG. 4. Sequence similarity groups found among Cry and Cyt proteins. Sequences
were aligned by using CLUSTAL W and a phylogenetic tree was constructed
by NEIGHBOR as described in the accompanying work (79). The tree
was visualized as a radial phylogram by using the TREEVIEW application. The
proposed similarity groups are indicated by shading.



a fold similar to that of the plant lectin jacalin (330). Jacalin is
known to bind carbohydrates via the exposed loops at the apex
of its b-prism fold, whereas at least one Cry protein (Cry1Ac)
is believed to recognize carbohydrate moieties on its receptor
(188).
The b-sandwich structure of domain III could play a number
of key roles in the biochemistry of the toxin molecule. Li et al.
(222) suggest that domain III functions in maintaining the
structural integrity of the toxin molecule, perhaps by protecting
it from proteolysis within the gut of the target organism—but
of course all three domains would have to share this characteristic.
From studies in other systems where toxin-receptor
interaction leads to pore formation, it is known that b-strand
structures can participate in receptor binding (11, 71), membrane
penetration (283), and ion channel function (241, 242,
427). None of these roles has been ruled out for domain III of
Cry proteins; indeed, there is at least some evidence suggesting
a role for domain III in receptor binding in certain systems (see
“Mechanism of action” below).
Although solving the structure of one of the Cyt toxins has
not really clarified their toxic mechanism, the predominantly
b-sheet structure of Cyt2A suggests a pore based on a b-barrel
(223). Three of the strands are sufficiently long to span the
hydrophobic core of the membrane, and the sheet formed by
them shows an amphiphilic or hydrophobic character. Theoretically
the number of monomers required to form a barrel of
sufficient size would be four to six. Various laboratories (75,
243, 244) have observed that Cyt1A (which is believed to have
a common structure with Cyt2A) aggregates on the surface of
the target cell but not in solution prior to binding to the cell
surface. Using synthetic peptides, Gazit et al. (125) provided
further evidence that the Cyt1A toxin self-assembles within the
membrane and also identified two a-helices (A and C) that
appeared to be involved in both membrane interaction and
intermolecular assembly. Mathematical modeling hypothesized
that Cyt1A exists as a 12-toxin oligomer (243). No receptor-
binding motif could be identified in the Cyt2A structure,
although the use of monoclonal antibodies has identified a
putative cell binding region on Cyt1A (76). Using a number of
different biophysical techniques, Butko et al. (55) have also
studied the interaction of Cyt1A with lipid membranes. They
observed a considerable loosening of the tertiary structure of
the toxin upon lipid binding but could find no evidence that the
toxin actually enters the membrane. The authors suggest that
Cyt1A exerts its effect via a general, detergent-like perturbation
of the membrane.
MECHANISM OF ACTION
General Features
The mechanism of action of the B. thuringiensis Cry proteins
involves solubilization of the crystal in the insect midgut, proteolytic
processing of the protoxin by midgut proteases, binding
of the Cry toxin to midgut receptors, and insertion of the
toxin into the apical membrane to create ion channels or pores.
Crystals are comprised of protoxins. For the protoxins to become
active, a susceptible insect must eat them. For most
lepidopterans, protoxins are solubilized under the alkaline
conditions of the insect midgut (162). Differences in the extent
of solubilization sometimes explain differences in the degree of
toxicity among Cry proteins (18, 98). A reduction in solubility
is speculated to be one potential mechanism for insect resistance
(265). For at least one protein, Cry3A, nicking by chymotrypsin-
like enzymes in the midgut may be necessary for
solubilization (60).
After solubilization, many protoxins must be processed by
insect midgut proteases (203, 379) to become activated toxins.
The major proteases of the lepidopteran insect midgut are
trypsin-like (204, 270) or chymotrypsin-like (174, 280, 297).
The Cry1A protoxins are digested to a 65-kDa toxin protein in
a processive manner starting at the C terminus and proceeding
toward the 55- to 65-kDa toxic core (69, 73). The carboxyterminal
end of the protoxin, which initially appears to be
wound around the toxin in an escargot-like manner, is clipped
off processively in 10-kDa sections during processing of the
protoxin (74). An interesting and unexpected finding is that
DNA is intimately associated with the crystal and appears to
play a role in proteolytic processing (38, 76a). The mature
Cry1A toxin is cleaved at R28 at the amino-terminal end (277);
Cry1Ac, at least, is cleaved at K623 on the carboxy-terminal
end (37). Two stages of processing have been detected for
Cry1Ia with trypsin or Ostrinia nubilalis midgut proteases: a
fully toxic intermediate, with an N terminus at protoxin residue
45 and a C terminus at residue 655 or 659, is further processed
to a partially toxic core, with an N terminus clipped to residue
156 (340).
Activated Cry toxins have two known functions, receptor
binding and ion channel activity. The activated toxin binds
readily to specific receptors on the apical brush border of the
midgut microvillae of susceptible insects (161–163). Binding is
a two-stage process involving reversible (161, 162) and irreversible
(166, 307, 395) steps. The latter steps may involve a
tight binding between the toxin and receptor, insertion of the
toxin into the apical membrane, or both. It has been generally
assumed that irreversible binding is exclusively associated with
membrane insertion (166, 307, 395). Certainly the recent report
that truncated Cry1Ab molecules containing only domains
II and III can still bind to midgut receptors, but only reversibly,
supports the notion that irreversible binding requires the insertion
of domain I (116). Yet at least some published data is
consistent with the notion of tight binding to purified receptors.
Tight binding of Cry1Aa and Cry1Ab to purified Manduca
sexta aminopeptidase N (APN) has been observed (256), and
Cry1Ac may also show some degree of irreversible binding to
M. sexta APN. There are likewise indications of irreversible
binding for Cry1Ac to purified Lymantria dispar APN (172,
389). Finally, Vadlamudi et al. (385) calculated similar binding
constants when toxin bound to brush border membrane vesicles
(BBMV) and to nitrocellulose-immobilized receptor (i.e.,
a ligand blot).
In M. sexta, the Cry1Ab receptor is believed to be a cadherin-
like 210-kDa membrane protein (119, 180, 385), while
the Cry1Ac and Cry1C receptors have been identified as APN
proteins with molecular masses of 120 and 106 kDa, respectively
(183, 234, 329). Incorporation of purified 120-kDa APN
into planar lipid bilayers catalyzed channel formation by
Cry1Aa, Cry1Ac, and Cry1C (335). These receptor assignments
can be difficult to reconcile with some ligand blot binding
data, however (90, 208). There is also some evidence that
domain II from either Cry1Ab or Cry1Ac can promote binding
to the larger protein, while domain III of Cry1Ac promotes
binding to the presumed APN (91). Alkaline phosphatase has
also been proposed to be a Cry1Ac receptor (329). The recent
cloning of the putative 210-kDa (386) and 120-kDa (184)
Cry1Ac receptors opens exciting possibilities for studies on
toxin-receptor interactions. In Heliothis virescens, three aminopeptidases
bound to Cry1Ac on toxin affinity columns. One of
them, a 170-kDa APN, bound Cry1Aa, Cry1Ab, and Cry1Ac,
but not Cry1C or Cry1E. N-Acetylgalactosamine inhibited the
binding of Cry1Ac but not that of Cry1Aa or Cry1Ab. The
three Cry1A toxins each recognized a high-affinity and a low- affinity binding site on this 170-kDa APN (235). In gypsy moth
(L. dispar), the Cry1Ac receptor also seems to be APN, while
Cry1Aa and Cry1Ab bind to a 210-kDa brush border membrane
vesicle (BBMV) protein (388, 389). In Plutella xylostella
(236) and Bombyx mori (425) as well, APN appears to function
as a Cry1Ac binding protein. An M. sexta gene encoding a
Cry1Ab-binding APN has also been cloned, as has its P. xylostella
homolog (92).
Insertion into the apical membrane of the columnar epithelial
cells follows the initial receptor-mediated binding, rendering
the toxin insensitive to proteases and monoclonal antibodies
(415) and inducing ion channels or nonspecific pores in the
target membrane. In vitro electrophysiological studies of voltage-
clamping of lipid bilayers (338, 348) and sections of whole
insect midguts (67, 68, 153, 225, 307) support the functional
role of the toxin in pore or ion channel formation. The nature
of the ion channel or pore-forming activity of Cry toxins in the
insect is still controversial. It is alternatively described as a
large lytic pore that is not specific for particular ions (see
reference 187 and “Structure-function interpretations”) or as
an ion-specific channel that disrupts the membrane potential
but does not necessarily lyse midgut epithelial cells (see below).
Several recent reviews have considered the mechanism or
mode of action of Cry toxins (126, 134, 158, 185, 186, 378, 412,
424). Some of these reviews have presented models for the
mode of action. The present review considers the newest primary
data on receptor binding and ion channel activity and
critically evaluates the extant models.
General Receptor Binding and Kinetic Considerations
Soon after methods were developed for preparing insect
BBMV (411), BBMV became the subjects of toxin binding
studies (323, 413). Several groups were able to correlate a
toxin’s insect specificity with its affinity for specific receptors on
BBMV of susceptible insects (162, 163, 395). In vivo experiments
have also confirmed that Cry proteins bind to microvillae
in the midgut (49, 93, 426).
A set of in vitro-constructed reciprocal recombinants between
Cry1Aa and Cry1Ac (130, 131) provided evidence that
insect specificity was localized in the central domain of the
toxin for some insects (B. mori and Trichoplusia ni) and the
central and C-terminal domains for others (H. virescens). Visser
et al. (397) reviewed the use of domain substitutions to
locate specificity regions. Van Rie et al. (395) demonstrated
that receptor binding correlated with insect specificity, and Lee
et al. (209) demonstrated that the specificity and binding domains
were colinear for Cry1Aa against B. mori. Examination
of the crystal structure of Cry3A (222) suggested a physical
basis for receptor binding (see “Toxin structure,” above) by the
loops of domain II. This suggestion has now been substantiated
by site-directed mutagenesis.
Early work by Hoffman et al. (162), Van Rie et al. (395), and
others employed competition binding studies to demonstrate a
correlation between toxin affinity and insecticidal activity. In a
paradoxical finding, however, Wolfersberger (413) observed
that Cry1Ab was more active than Cry1Ac against gypsy moth
larvae, despite exhibiting a relatively weaker binding affinity.
Other examples of this phenomenon—a lack of correlation
between receptor binding affinity and insecticidal activity—are
now known (123, 327, 395). Liang et al. (224) evaluated binding
affinity and dissociation (both reversible and irreversible
binding) of Cry1Aa, Cry1Ab, and Cry1Ac with gypsy moth
BBMV. While they confirmed that the affinity of Cry1Ab was
not directly related to toxin activity, they did observe a direct correlation between the irreversible binding rate and toxicity.
Ihara et al. had earlier stressed the importance of considering
irreversible binding in explaining the difference in toxicity of
Cry1Aa and Cry1Ab to B. mori (166).
Prior to the work of Liang et al. (224), kinetic analysis of Cry
toxin-receptor binding relied on the Hill (161) or Scatchard
(395) equations that assume a strictly reversible binding:
 

where T is a Cry toxin, R is a receptor for this toxin, T[R is a
toxin that is reversibly bound to the receptor, Kd1 is the dissociation
constant k1 is the on rate, and k21 is the off rate.
In reality, the toxin becomes irreversibly associated with the
apical membrane by insertion (415), giving the following kinetic
diagram (224) (including two models for the inserted
state of the toxin):
 

where T, R, and T[R are as described for equation 1; *T is an
irreversibly bound toxin, presumably inserted into the membrane
but not associated with a receptor; and *TR is an irreversibly
bound toxin which is still associated with a receptor.
Given the irreversible rate component k2, the reaction cannot
reach equilibrium; as the toxin-receptor complex is formed,
it is drained away by insertion. Therefore, competition or binding
experiments under conditions where insertion can take
place (equation 2) do not yield true Kd values (224). Since
equilibrium conditions are not obtained, equation 2 should not
be considered any more valid for calculation of a classical
dissociation constant, Kd, than equation 1. Alternate values,
such as the 50% inhibitory concentration (224, 257) or Kcom,
the so-called competition constant (206, 208, 308, 422), have
been used for Kd under these conditions. Under some conditions
insertion should not occur, i.e., ligand blotting of 125Ilabeled
Cry1Ac to purified gypsy moth 120-kDa receptor (207)
or binding of unlabeled Cry1Ac to purified M. sexta 120-kDa
receptor fixed to dextran surfaces in surface plasmon resonance
analysis (256). In both cases, the calculated Kd was 100
times that obtained with BBMV, suggesting that the effect of k2
upon the reversible reaction is considerable. In contrast, competition
binding of Cry1Ab to the 210-kDa receptor on a ligand
blot differed little from calculated competition binding to M.
sexta BBMV (385) or to the cloned 210-kDa receptor expressed
in human embryonic 293 cells (386) (708 pM, 1,000
pM, and 1,015 pM, respectively). It may be that the rate of
insertion, k2, is negligible for the 210-kDa receptor, perhaps
due to either extremely tight binding to this receptor or a
failure to insert.
Role of Domain II Loop Regions
The prediction that domain II is involved in receptor binding
(131, 222) has led to extensive substitution of loop residues in
this domain in Cry3A, Cry1A, and Cry1C by mutagenesis (Fig.
5). Data on the effects of mutations in sequences encoding
domain II loop regions of selected Cry toxins are summarized
in Table 1. Perusal of these data indicates that mutations may
have either a negative or positive effect on binding and toxicity
and that mutations in different loop regions, sometimes involving
the same type of amino acid residue, can have a different
effect on binding. Minor changes in binding usually do not have
a major effect on toxicity, but a major positive or negative effect has a corresponding positive or negative effect on toxicity.
Furthermore, either binding affinity (as measured by competition
binding) or irreversible binding may effect toxicity, and for
a few mutant proteins one of these parameters may be positive
(increased affinity) while the other may be negative (increased
dissociation), with an overall negative effect on toxicity. It is
apparent that the same mutation in a toxin can have quite
different results on different insects. A more complete description
of domain II loop mutations is given in a recent review
(311).
In summary, the binding picture for domain II is complex.
Results clearly suggest that all of the loops of domain II can
participate in receptor binding, although perhaps not all at the
same time for a given insect or receptor. Different toxins may
have the same amino acid sequence in the loops of domain II
(e.g., Cry1Ab and Cry1Ac) yet bind to different receptors, at
least on ligand blots. The available data seem to show an
intriguing similarity between the receptor binding loops of
domain II and other known protein-protein epitopes; i.e., a
hydrophobic residue capable of tight binding to the receptor is
surrounded by hydrophobic or charged residues. Similar interactions
have been noted in several other systems (for a general
review, see reference 300). A striking demonstration of the
importance of a hydrophobic residue in irreversible binding
was a series of mutations in F371 of Cry1Ab loop 2 to residues
of lower hydrophobicity. This reduction in hydrophobicity was
correlated with the gradient of reduced irreversible binding
and toxicity (309).
Not included above is a discussion of work on two putative
surface loops of domain II of Cry1C (loop 1, 317GRNF320, and
loop 2, 374QPWP377) (350). This study did not evaluate the
effect of mutational alteration of loop residues on binding, but
examined cytotoxicity with cultured Spodoptera Sf9 cells and
toxicity with Aedes aegypti larvae. The results indicated that
specificity differences for Cry1C between Sf9 cells and A. aegypti
larvae could be changed radically by single point mutations
in the loops. For example, an R-to-I mutation at position
318 (R318I) abolished mosquitocidal activity but retained 80%
cytotoxicity to Sf9 cells. Likewise, several mutations caused a
loss of mosquitocidal activity with only a marginal loss of cytolytic
activity against Sf9 cells. Substitutions that altered the
charge, such as Q374E, completely abolished activity against
both cells and mosquito larvae.
Role of Domain III in Receptor Binding
Domain III has also been implicated in receptor binding. As
mentioned above, several groups (130, 331) have suggested a
role for domain III of Cry1Ac in H. virescens specificity. Masson
et al. (258) extended the suggestion to include CF-1 cells.
Aronson et al. (19) mutated a hypervariable region of domain
III (residues 500 to 509) of Cry1Ac. Mutations S503A and
S504A resulted in lower toxicity to M. sexta, with a corresponding
decrease in binding to BBMV proteins on ligand blots. Lee
et al. (211) analyzed homolog scanning mutants that exchanged
domain III between Cry1Aa and Cry1Ac. Hybrid proteins
containing the Cry1Aa domain III bound a 210-kDa receptor
while hybrid proteins containing the Cry1Ac domain III
bound a 120-kDa receptor in gypsy moth. Domain switching
experiments have also suggested a role for Cry1Ab domain III
in binding to S. exigua (90). Finally, there is one report suggesting
a biotin-binding activity for domain III (99), although a
role for this activity in receptor binding has not been demonstrated
directly.
 

Membrane Insertion
Mutations in domain I have been shown to affect the ability
of the toxin to dissociate from the binding complex. Wu and
Aronson (419) created several mutations in domain I of
Cry1Ac. The A92D and R93G mutations (at the base of a3)
dramatically reduced toxicity to M. sexta. A loss of toxicity by
the A92D mutation was also observed in Cry1Aa and Cry1Ab.
A series of substitution residues at the 92 and 93 positions
revealed that at position 92 only a negatively charged residue
caused a loss of toxicity. Any substitution of R93 except the
positively charged Lys caused a loss of toxicity. The authors
concluded that a positively charged surface is important for
toxicity. Chen et al. (67) repeated the mutation at the A92
position in Cry1Ab with A92E. In agreement with Wu and
Aronson’s result (419), toxicity was almost completely lost.
Although competition binding of the mutant toxin to M. sexta
was not affected, irreversible binding was severely disrupted.
Chen et al. (67) further demonstrated that Y153 mutations (at
the loop between the bottoms of a4 and a5, on the same
surface as A92E) introducing a negative charge had a negative
effect on membrane insertion.
In summary, binding studies reveal three types of mutants.
Certain mutations in domain II (A mutants) affect competition
but not dissociation. Examples are Cry1Ab 368RRP370 (309)
and Cry1Ab loop 3 mutations F440A and G439A (310). Certain
other mutations in domain II (B mutants) affect dissociation
but not competition. Examples are Cry1Ab F371A (and most
other substitutions except Trp) and G439A (307). In domain I,
certain mutations (C mutants) affect insertion of toxin into the
membrane. The distinction between B and C mutants may be
arbitrary; it assumes different functions for domains I and II, a
point still lacking definitive proof. Examples of C mutants are
Cry1Ac A92D or R93G (419) and Cry1Ab A92E or Y153D (67).
In the above cases, all of these effects were observed in the
same toxin (Cry1Ab) and insect (M. sexta) system. Cry3A loop
3 mutants have also been described in which effects on both
competition and dissociation were observed (422).
Masson et al. (256) describe differences in off rates for two
Cry1Ac toxins that differ in three residues: L366F, F439S, and a
deletion of D442. While these differences might be due to other
causes, it is interesting that position 366 and positions 439 to
442 occur in loops 2 and 3, respectively. Wells (402) describes
human growth hormone mutants in which alanine substitution
of positively charged residues affects on rates, and other alanine-
scanning mutants in large hydrophobic residues affect off
rates. A similar pattern is observed in the Cry toxin mutations
of the receptor binding loops. Positive residues may be involved
in long-range orientation of the toxin to the receptor,
affecting the on rate. In some cases, large hydrophobic residues
were involved in tight binding, and their mutants affected the
off rate; in other cases, mutations in large hydrophobic residues
affected competition binding (that is, on rates).
Ion Channel Activity
The ion channel activity of Cry toxins has been explored by
a wide variety of techniques. The toxin has been studied with
complete proteins, with domain I in isolation, with synthetic
peptides mimicking particular a-helices, and with mutants that
disrupt ion channel function.
Considerable work has been reported on the effects of Cry
toxins on insect tissue culture cells. Work with CF-1 cells has
led to the colloidal osmotic lysis model for the cytolytic activity
of Cry toxins (187). This model proposes that an influx of
water, along with ions, results in cell swelling and eventually
lysis. When exposed to microgram amounts of activated toxin,
cells leaked a variety of electrolytes tested, including CrO4
22,
uridine, and Rb1. Under these conditions, then, Cry toxins
form a nonspecific pore. Wolfersberger (412) lists the problems
that arise from experiments with established cell cultures.
The cells are normally maintained at a pH of 6.8—not the basic
pH found in the lumen of many insect midguts. They lack
normal midgut receptors (161) and do not respond as specifically
to toxins as does the whole insect (410). They are tolerant
to nearly 1,000-fold-greater levels of toxin than insects under
physiological conditions (187). From experiments on tissue
culture cells it is clear, however, that Cry toxins have a fairly
general capacity to insert into membranes and form large,
nonspecific pores under certain conditions, including hightoxin
concentrations, long incubation times, and relatively low
pHs.
Several techniques have been employed to study the ion
channel activity of the B. thuringiensis Cry proteins. Harvey and
Wolfersberger (153) used electrophysiological analysis of sections
of whole midgut of M. sexta to measure short circuit current inhibition (ISC). The mechanism of ISC is explained in
the excellent review by Wolfersberger (412). Results of recent
studies (67, 68), using nanomolar concentrations of toxin, have
supported the validity of the voltage clamping technique as an
assessment of Cry toxin activity correlating well with bioassays.
Several groups have examined Cry toxin ion channel activity
in planar lipid bilayer (PLB) systems. Slatin et al. (348) examined
Cry1Ac and Cry3A in PLB membranes of various compositions
and found that toxins formed cation-selective channels.
Cry1Ac ion channels exhibited multiple opening and
closing states (indicating more than one single-channel conductance
level or cooperative gating). Cry1Ac channels were
commonly 600 pS in size (in 300 mM KCl), while Cry3A
formed larger channels of 4,000 pS. Channels did not form at
pH 7 but did form at pH 9.7.
In a pivotal paper on Cry protein ion channel activity,
Schwartz et al. (338) reported a pH effect on the type and size
of ion channels made by Cry1C in PLBs. Under alkaline conditions
(pH 9.5), cationic channels of 100 to 200 pS were
formed, exhibiting multiple conductance states. Under acidic
conditions (pH 6.0), anionic channels of different sizes (8 to
120 pS) were observed. These channels were inhibited by zinc
added to the cis chamber, but not to the trans chamber, indicating
directionality of the channel. The authors note that
behavior of the toxins at pH 6 is similar to that recorded in
native membranes of cultured insect cells (grown at pH 6.3)
(337). This observation may clarify the nonselectivity of Cry
proteins on cultured insect cells (187). The physical basis of
pH-dependent selectivity may be related to the observation
that a-helical content, as measured by circular dichroism,
changes radically with pH (72, 111, 189). It is speculated that
pH can alter the pitch or arrangement of the a-helices of
domain I and change the nature of the ion channel. In general,
the role of pH in ion specificity is thought to be by titration of
charged amino acids lining the aqueous pore, but pH changes
on Cry channels have global effects on ion specificity and pore
size.
Channel formation in PLBs has also been observed with
N-terminal fragments (essentially domain I) of Cry1Ac (399)
and Cry3Bb (398), and with a5 helix peptides of Cry1Ac (80)
and Cry3A (127, 128). The a7 helix alone did not form channels,
but in the presence of the a5 helix it assembled and
penetrated membranes better than did a5 complexes alone
(126). Channels formed by the a5 helix, unlike those formed by
full-length toxins, are small (60 pS) and hemolytic (127) and
prefer acidic phospholipid vesicles (80, 127). The channels
formed with Cry1Ac N-terminal fragments differed from those
formed by whole toxins in having only a single conductance
state, being less cation selective, and showing no toxicity to
whole insects. They did, however, have similar conductance
levels (200 to 600 pS). They also exhibited twice the Rb1 efflux
from phospholipid vesicles as did full-length toxins (399). In
contrast, N-terminal fragments of Cry3Bb were quantitatively
similar to the full-length toxin, but exhibited less Rb1 efflux
than full-length toxins with phospholipid vesicles. In summary,
these results show qualitative support for the model that domain
I constitutes, or at least participates in, the ion channel.
Domain III has also been reported to play a role in ion
channel activity. Chen et al. (68) analyzed an alternating arginine
region in b-sheet 17 (conserved block 4), a sequence
superficially similar to the positively charged face on the S-4
helix in classical ion channels. While alteration of the central
arginines caused structural alterations in Cry1Aa, conservative
substitutions of the outermost arginines were stable and led to
reduction of activity, as measured by bioassays and by voltage
clamping of M. sexta midgut sections. These altered toxins were
also examined by the BBMV permeability-light scattering assay
(414) and in lipid bilayers for conductance (336). Both
methods detect an alteration of ion channel activity caused by
these conservative alterations in this b-sheet of domain III.
Reconstitution systems involving BBMV fused with lipid
bilayers have been recently reported from two laboratories.
Martin and Wolfersberger (254) measured Cry1Ac channels in
PLBs that were fused with M. sexta BBMV. The addition of 1.5
nM of toxin resulted in very large channels (.260 nS) at pH
9.6. The smallest toxin-dependent increase in conductance was
13 nS, which may represent a single membrane pore. Thus,
these channels were capable of very large changes in conductance
state (in 13-nS increments) but were never observed to
close. Channel behavior was also pH dependent. At pH 8.8,
smaller channels of 2 to 3 nS were observed. The authors
concluded that pores of the largest size would be 2.2 nm in
diameter (more than twice the diameter previously measured
in bilayers), and that such differences in properties favor active
involvement of BBMV proteins in the pore formation. More
recently Carroll and Ellar (62) measured the size changes of M.
sexta BBMV in an environment of high osmotic pressure and
high Cry1Ac concentrations. The rate of Cry1Ac-induced
swelling varied with the radius of the solutes used, allowing for
an estimate of Cry1Ac pore size. Under these conditions, large
pores were formed (2.4 nm at pH 8.7 and 2.6 nm at pH 9.8).
Lorence et al. (230) also have reported intrinsic ion channels
in S. frugiperda BBMV. These cationic channels were small (31,
47, and 76 pS), of low selectivity (permeability relative to K1 is
.80% for Na1, Li1, Cs1, Rb1, and NH4
1), and were inhibited
by standard channel blockers. The addition of Cry1C or
Cry1D toxin resulted in large cationic channels of 50, 106, and
360 pS that showed greater K1 selectivity but were not exclusively
K1 channels. The Cry1D channels formed in whole S.
frugiperda BBMV were reported to be blocked by Ba1 and
Ca21 and less so by triethanolamine, in agreement with an
earlier report on the blocking of inhibition of ISC on M. sexta
midguts (77). These experiments were performed at pH 9.0; no
anionic channels were observed under these conditions. The
latter result differs from light scattering results from M. sexta
BBMV with Cry1Ac at pH 7.5 (61). Interestingly, while the
insecticidal activity against first-instar S. frugiperda for Cry1C
was greater than that for Cry1D, the channel-forming activities
for Cry1C and Cry1D on BBMV taken from second-instar
larvae were equal and that for Cry1C was less than that for
Cry1D on BBMV from fifth-instar larvae. Clearly the fused
BBMV-lipid bilayer studies raise interesting questions and
open new avenues for understanding Cry toxin action.
Mutants with Enhanced Activity
A primary goal of protein engineering of the Cry proteins is
to create better pesticides through rational design. A few examples
of this effort are now starting to appear. A mutation
(H168R) in helix a5 of Cry1Ac, domain I, caused a twofold
increase in toxicity against M. sexta (419). Further characterization
of this mutant (165) revealed that the increased toxicity
was correlated with the rate of irreversible binding (kobs). Jellis
et al. (171) have also described multiple mutations in domain
I that increased toxicity; however, the mechanism of action of
these mutants has not been addressed. An R204A mutation in
domain I of Cry4B resulted in a threefold increase in activity
against mosquitoes, perhaps by removing a site of proteolytic
instability (16).
Several mutations in domain II have led to increased toxicity.
Loop 3 (481MQGSRG486) of domain II Cry3A was mutated
to alanines, and a 2.4-fold increase in toxicity against Tenebrio molitor was observed (422). An increase in irreversible binding
was correlated with this increase in toxicity. Other mutations in
loop 1 of Cry3A have significantly improved toxicity against T.
molitor (11.4-fold); Chrysomela scripta, cottonwood leaf beetle
(2.5-fold); and Leptinotarsa decemlineata, Colorado potato
beetle (1.9-fold) (423). An increase in irreversible binding was
correlated with the increase in toxicity for these mutants as
well. In Cry1Ab, a combination of mutations in the a8 loop and
loop 2 resulted in a 32-fold increase in toxicity to L. dispar over
the background gene product and a 4-fold improvement over
the previously best-known gene product (Cry1Aa) (308). The
mechanism of increase in toxicity is correlated to improvement
in initial binding affinity in this case.
In summary, the B. thuringiensis Cry protein behaves as a
bona fide ion channel in lipid bilayers and in the midgut epithelium.
As such it represents one of the few ion channels that
has a known structure. The contradictory results and confusion
concerning the selectivity and size of the pore may be due to
the range of experimental conditions employed but more importantly
may reflect the adaptability of the toxin to different
physiological conditions which exist in its functional environments.
In the alkaline midgut, the toxin may function as a
cation channel (338), taking advantage of the large K1 gradient
that exists in some insect midgut environments. As the pH
falls due to cell lysis or leakage, the toxin may function as an
anion channel (338), further wounding the epithelial cells. In
large amounts, the Cry protein may form very large leakage
pores, resulting in cell lysis and disruption of the midgut epithelium.
Continued intensive research effort, now under way,
will clarify the mechanism of action of the Cry proteins.
Effect of Synergistic Interactions on Toxin Potency
B. thuringiensis subsp. israelensis. Wu and Chang (420) were
the first to observe that when protein fractions from the purified
inclusion body of B. thuringiensis subsp. israelensis were
mixed and assayed against A. aegypti larvae, the activity of
some combinations was greater than would have been expected
from the activity of the individual fractions. Other reports
followed, confirming synergistic interactions among various
toxins of B. thuringiensis subsp. israelensis (15, 64, 70, 78,
85, 303, 421). In evaluating these studies, it is difficult to establish
the precise contribution of each toxin (either alone or in
combination) towards the overall toxicity of the inclusion. Part
of the problem is the large variation in reported toxicities for
individual toxins, probably due to differences in experimental
conditions. Complicating factors include host-dependent differences
in the size, quality, and solubility of crystals among the
various expression systems used (15); differences in presenting
the proteins to the larvae (soluble or reprecipitated form);
variation in bioassay conditions, including larval age and diet;
and natural variation in insect populations (317).
A recent study (78) attempted to overcome these problems
by assaying the toxins under constant experimental conditions.
From these data, it can be deduced that the order of relative
activities of the individual toxins against A. aegypti larvae
(based on the 50% lethal concentration [LC50]) is (from greatest
to least) Cry11A, Cry4B, Cry4A, and Cyt1A. Synergistic
interactions were demonstrated with all combinations of toxins
used, although the extent of this interaction was dependent on
the combination. No combination, however, was as active as
was the native B. thuringiensis var. israelensis inclusion. There
might be additional factors important for toxicity associated
with the native crystal. It is also possible that native crystals
might be ingested or solubilized more efficiently than those
from the recombinant strains are. Additionally, the presentation
of all four toxins in a single crystal might be more efficient
than a mixture of four inclusions.
In an alternative approach to study the relative contributions
of the B. thuringiensis var. israelensis toxins to the overall toxicity,
strains have been made in which either the cry11A gene or
the cyt1A gene were genetically inactivated. The effect of inactivating
cry11A (301) was to halve the toxicity of the resulting
strain to A. aegypti larvae. In contrast, inactivating the cyt1A
gene (84) produced a strain with similar toxicity to the native
strain, suggesting that Cyt1A was not essential for mosquitocidal
activity. In interpreting those results, however, one
should keep in mind the relative activities of the individual
toxins (78). If the crystals produced by the cyt1A null mutant
contain relatively greater proportions of the more active toxins
than those found in wild-type crystals, one would expect the
mutant strain to be considerably more toxic than the wild-type
strain. The fact that the presence of Cyt1A in crystals does not
dilute their potency suggests that this protein is indeed an
important component of the B. thuringiensis subsp. israelensis
mosquitocidal arsenal. As such, Cyt1A may provide a redundant
set of synergistic interactions.
Little is known about the mechanism of this synergistic interaction.
A comparison of the dose-response curves for the
individual B. thuringiensis subsp. israelensis toxins (78) shows a
clear difference between Cyt1A and the Cry toxins. Thus,
Cyt1A may act in a different way than the Cry toxins. Cyt1A
has a completely different structure than the Cry toxins (223)
and appears to interact with a different type of receptor (375).
Ravoahangimalala and Charles (312) found that Cyt1A, when
added alone to midgut tissue sections of Anopheles gambiae,
bound to the microvilli of all midgut and anterior stomach cells
(with the exception of the peritrophic membrane-secreting cardia
cells). In contrast, the Cry toxins bound only weakly to
anterior stomach cells. When the complete set of B. thuringiensis
subsp. israelensis toxins were added to insects in vivo, Cyt1A
was not found to be bound to the anterior stomach cells (313).
Although this negative result could have been an artifact, it
might also represent a strong association between the Cry and
Cyt toxins that could form the basis of a synergistic interaction.
An additional consequence of this synergism is discussed under
“Resistance Management” below.
Much of the work discussed above was concerned with activity
against A. aegypti larvae. Synergism has also been established
between different toxin combinations against both Culex
pipiens and Anopheles stephensi (85, 303).
Other B. thuringiensis strains. Synergistic interactions between
toxins other than those from B. thuringiensis subsp. israelensis
were reported in 1991 by van Frankenhuyzen et al.
(393). Interactions were observed between the individual Cry1
toxins of HD-1 against a number of forest-defoliating insects.
The data presented in that report (393) were later reevaluated
by Tabashnik (363), who applied a more rigorous mathematical
treatment to the toxicity data and concluded that synergism
could not, in fact, be satisfactorily demonstrated. Recently,
however, synergism has been observed between Cry1 proteins.
The relative toxicities of Cry1Aa, Cry1Ab, and Cry1Ac against
L. dispar and B. mori were investigated in force-feeding experiments
(207). While synergism was observed between Cry1Aa
and Cry1Ac for L. dispar by using the mathematical approach
of Tabashnik (363), an antagonistic effect was exhibited between
Cry1Aa and Cry1Ab. No synergistic effect on B. mori
was observed with any toxin combination. The authors also
noted that synergistic interactions were observed both in the
bioassay and in ISC. The authors speculated that the pores
formed by different toxins act in a cooperative way or that a
more efficient pore is formed from a hetero-oligomer of dif- ferent toxins. The presence of certain toxins might enhance the
activity of another by preventing nonproductive binding. Whatever
the actual mechanism, it is clear that the interaction is
insect specific, a fact that may reflect differences in receptor
affinities for each toxin.
In addition to synergistic interactions between different toxins,
similar potentiating effects on toxicity have been observed
between certain toxins and spores (85, 100, 173, 271, 273, 372)
and also between toxins and other bacteria (100). In each case,
septicemia caused by the spores or bacteria infecting the insect,
whose midgut has become ulcerated as a result of the toxin, is
believed to be the cause of this observed synergism. In addition,
the presence of the B. thuringiensis spore with the Cry
proteins may even reduce the likelihood of insect resistance
development in some instances (272).
BIOTECHNOLOGY OF B. THURINGIENSIS
Application of Cry Proteins for Pest Control
and Plant Protection
B. thuringiensis is now the most widely used biologically
produced pest control agent. In 1995, worldwide sales of B.
thuringiensis were projected at $90 million (353), representing
about 2% of the total global insecticide market (199). Rowe et
al. (322) reported that the annual worldwide distribution of B.
thuringiensis amounts to 2.3 3 106 kg. As of early 1998, there
were nearly 200 registered B. thuringiensis products in the
United States (Table 2) (381). While the use of biological
pesticides in agriculture remains significantly behind that of
synthetic chemical pesticides, several environmental and safety
considerations favor the future development of B. thuringiensis.
Cry proteins that have been studied thus far are not pathogenic
to mammals, birds, amphibians, or reptiles, but are very specific
to the groups of insects and invertebrate pests against
which they have activity. Cry-based pesticides generally have
low costs for development and registration. B. thuringiensis
subsp. israelensis, for example, had a development cost estimated
at 1/40 that of a comparable novel synthetic chemical
pesticide (32). Finally, the mode of action for the Cry proteins
differs completely from the modes of action of known synthetic
chemical pesticides, making Cry proteins key components of
integrated pest management strategies aimed at preserving
natural enemies of pests and managing insect resistance.
Forestry
The transfer of emphasis to environmentally friendly pesticides
that have minimal effects on natural enemies of Lepidoptera
(14) has already begun in the forests of the United States,
where B. thuringiensis has become the major pesticide used
against the gypsy moth (239). B. thuringiensis products for the
forest industry have been based primarily on B. thuringiensis
HD-1 subsp. kurstaki (102), which produces Cry1Aa, Cry1Ab, Cry1Ac, and Cry2Aa toxins. The gypsy moth is by no means the
only forest pest that can be controlled successfully with B.
thuringiensis (392, 393). Currently targeted pests include the
spruce budworm (Canada), the nun moth (Poland), the Asian
gypsy moth (United States, Canada, and the Far East), the
pine processionary moth (Spain and France), and the European
pine shoot moth (South America) (46).
Control of Mosquitoes and Blackflies
Since its discovery in 1977 (136), B. thuringiensis subsp. israelensis
has proved to be one of the most effective and potent
biological pesticides (for reviews, see references 32 and 81). Its
discovery came at an auspicious moment because of the
mounting resistance of mosquitoes and blackflies to synthetic
chemical pesticides. Five B. thuringiensis subsp. israelensis cry
and cyt genes encode dipteran-active toxins: cry4A, cry4B,
cry10A, cry11A, and cyt1A (cytolysin). In addition, the Cyt1A
cytolysin may synergize the activity of other Cry toxins (see
“Effect of synergistic interactions on toxin potency”). These
five genes are all found on a large plasmid of about 72 MDa
that can be transferred to other B. thuringiensis strains by a
conjugation-like process (137). Interestingly, this same set of
toxins has also been discovered in isolates from several other
B. thuringiensis serotypes (286), suggesting that the conjugation
process analyzed in the laboratory may have environmental
significance for horizontal transfer of cry genes among B. thuringiensis
populations.
Given the severe impact of mosquito- and blackfly-borne
human diseases, there is considerable interest in identifying
additional dipteran-active toxins. Mosquitocidal activity has
been reported for Cry2Aa (408), Cry1Ab (150, 151), and
Cry1Ca (352). The cytolytic Cyt1A and Cyt2A crystal proteins
also show some degree of dipteran specificity in vivo (191).
New mosquitocidal cry genes have also been recently reported
(e.g., cry11B and cry16A [85]), as well as several new isolates
containing uncharacterized cry genes with mosquitocidal activity
(289, 306). A surprising source of additional Cry-related
mosquitocidal proteins is the bacterium C. bifermentans subsp.
malaysia (23, 82), the toxins of which we have designated
Cry17A, Cry18A, and Cry19A in the accompanying paper (79).
Developing New Cry Biopesticides Based
on B. thuringiensis
B. thuringiensis has evolved to produce large quantities of
crystal proteins (for reviews, see references 8 and 30), making
it a logical host for developing improved Cry biopesticides.
Natural isolates of B. thuringiensis can produce several different
crystal proteins, each of which may exhibit different, perhaps
even undesirable, target specificity (164, 199). On the
other hand, certain combinations of Cry proteins have been
shown to exhibit synergistic effects (64, 78, 207, 303, 421).
Accordingly, genetic manipulation of B. thuringiensis—to create
combinations of genes more useful for a given purpose
than those known to occur in natural isolates—may be desirable.
A conjugation-like system has been used to transfer Cryencoding
plasmids from one strain to another (137), but most
cry genes are not readily transmissible by this process. Nevertheless,
a number of transconjugant and naturally occurring
strains producing Cry proteins distinct from those of B. thuringiensis
HD-1 subsp. kurstaki, including strains of B. thuringiensis
subsp. aizawai and B. thuringiensis subsp. morrisoni, have
been registered with the U.S. Environmental Protection
Agency.
A breakthrough development for engineering B. thuringiensis
and B. cereus came in 1989 when several groups independently
applied electroporation technology to transform vegetative
cells with plasmid DNA (34, 42, 214, 246, 259, 333).
These protocols differed in cell preparation methods, buffer
components, and electric pulse parameters, but each could
achieve frequencies of 102 to 105 transformants per mg of
plasmid DNA with a wide variety of hosts and vectors. Macaluso
and Mettus (238) added the important observation that
some B. thuringiensis strains restrict methylated DNA. Plasmid
DNA isolated from Bacillus megaterium or Dcm2 strains of E.
coli transformed B. thuringiensis with much higher frequencies
than did DNA isolated from B. subtilis or Dcm1 strains of E.
coli. Their data also provided evidence that several restriction
systems exist within the B. thuringiensis species. The use of
unmethylated DNA with the Macaluso and Mettus protocol
allows transformation frequencies as high as 3 3 106 to be
achieved.
A variety of shuttle vectors, some employing B. thuringiensis
plasmid replicons (17, 28, 63, 122), has been used to introduce
cloned cry genes into B. thuringiensis (124). Alternatively, integrational
vectors have been used to insert cry genes by homologous
recombination into resident plasmids (2, 219) or the
chromosome (176). Plasmid vector systems employing B. thuringiensis
site-specific recombination systems have been developed
to construct recombinant B. thuringiensis strains for new
bioinsecticide products (26, 29, 325, 326).
Homologous recombination has been used to create null
mutants in vivo. Applications of this technique have included
disruptions of cry and cyt genes to assess their contribution to
pesticidal activity (85, 301) and inactivation of protease production
genes to increase crystal production and stability (97,
370). Recent progress in understanding cry gene expression has
allowed the construction of asporogenous B. thuringiensis
strains that nevertheless produce crystals; these crystals remain
encapsulated in the mother cell compartment (48, 213). Much
remains unclear about the fate of naked Cry toxins in the
environment, although they appear to be quite sensitive to
degradation by natural soil microbes (404). It is a plausible but
untested hypothesis that encapsulation within the mother cell
can improve toxin persistence in sprayed applications.
Alternative Delivery Systems for Cry Proteins
Crystal genes were introduced into E. coli, B. subtilis, B.
megaterium, and Pseudomonas fluorescens long before there
was an efficient transformation system available for B. thuringiensis
(for a review, see reference 124). Fermentations of
recombinant pseudomonads have been used to produce concentrated
aqueous biopesticide formulations consisting of Cry
inclusions encapsulated in dead cells. These encapsulated
forms of the Cry proteins have been reported to show improved
persistence in the environment (121). Fermentations of
pseudomonads producing different Cry proteins can be combined
in a single formulation to expand the range of target
insects controlled. The production or activity of certain Cry
proteins in P. fluorescens has been improved by the use of
chimeric cry genes containing a substantial portion of the
Cry1Ab carboxyl-terminal region (376, 377). It is anticipated
that engineered forms of the Cry proteins showing improved
potency or yield, regardless of their host, will make Cry biopesticides
a more attractive and practical alternative to synthetic
chemical control agents.
The primary rationale for using live endophytic or epiphytic
bacteria as hosts is to prolong the persistence of Cry proteins
in the field by using a host that can propagate itself at the site
of feeding and continue to produce crystal protein. The cry1Ac gene, for example, has been introduced into the endophytic
bacterium Clavibacter xyli on an integrative plasmid (201), and
the resulting recombinant strain has been used to inoculate
corn for the control of European corn borer infestation (380).
Endophytic isolates of B. cereus have been used as hosts for the
cry2Aa gene (245), and a B. megaterium isolate that persists in
the phyllosphere (43) has been used as a host for cry1A genes.
Similarly, cry genes have been transferred into other plant
colonizers, including Azospirillum spp., Rhizobium leguminosarum,
Pseudomonas cepacia, and P. fluorescens (281, 282, 347,
361, 384). Alternative delivery systems have also been sought
for the dipteran-active toxins of B. thuringiensis subsp. israelensis
to increase their persistence in the aquatic feeding zone.
Such hosts include Bacillus sphaericus (22, 302), Caulobacter
crescentus (374), and the cyanobacteria Agmenellum quadruplicatum
(359) and Synechococcus spp. (355).
Expression of B. thuringiensis cry Genes in Plants
Several cry genes have been introduced into plants, starting
with tobacco (24, 387) and now including many major crop
species (5, 120, 193, 278, 294, 296, 391). Because this subject
has been well reviewed in recent years (107, 290), we will limit
our discussion to a few important points.
When unmodified crystal protein genes are fused with expression
signals used in the plant nucleus, protein production
is quite poor compared to that of similar transcription units
containing typical plant marker genes (390). Nucleus-directed
expression of full-length unmodified genes has been reported
for some plants (114, 115). However, truncation of the unmodified
genes to synthesize only the toxic portion of the protein
typically results in much improved, but still comparatively low,
expression (24, 114, 387).
The relatively A1T-rich Bacillus DNA contains a number of
sequences that could provide signals deleterious to gene expression
in plants, such as splice sites, poly(A) addition sites,
ATTTA sequences, mRNA degradation signals, and transcription
termination sites, as well as a codon usage biased away
from that used in plants. When the Bacillus sequences are
extensively modified, with synonymous codons to reduce or
eliminate the potentially deleterious sequences and generate a
codon bias more like that of a plant, expression improves
dramatically (5, 120, 193, 294, 296). In some cases, less extensive
changes in the coding region have also led to fairly dramatic
increases in expression (295, 390, 391). The study of van
Aarssen et al. (390) is noteworthy in that it points to fortuitous
splicing signals in the Bacillus coding region as being a significant
barrier to expression of cry1Ab in plants. In contrast to
expression from the nucleus, an unmodified cry1Ac gene was
expressed at very high levels in the chloroplasts of tobacco
(260).
The year 1996 marked a milestone in agricultural biotechnology:
for the first time, varieties of potato, cotton, and corn
containing modified cry genes were sold to growers. The production
of Cry proteins in planta can offer several benefits.
Because the toxins are produced continuously and apparently
persist for some time in plant tissue (345, 346), fewer applications
of other insecticides are needed, reducing field management
costs. Like B. thuringiensis-based biopesticides, such “enhanced
seed systems” are less harmful to the environment than
synthetic chemical insecticides and typically do not affect beneficial
(e.g., predatory and parasitic) insects. The plant delivery
system also expands the range of pests targeted for control with
Cry proteins, including sucking and boring insects, root-dwelling
insects, and nematodes.
In addition to concerns regarding the development of natural
resistance towards the B. thuringiensis toxins, the impact of
gene flow to wild relatives needs to be assessed. Preliminary
experiments documented the possibility of cross hybridization
among members of the family Brassicaceae and an increased
survivorship of Brassica napus with a B. thuringiensis transgene
under certain conditions (360). From these data it could be
inferred that transgenic B. napus may transfer its insecticidal B.
thuringiensis gene into wild relatives (360). However, analysis
with respect to the stable inheritance and expression of the insect-resistant phenotype in the offspring of any such hybrids
is needed to determine the likelihood and impact of such a
transfer.
Insect Resistance to B. thuringiensis Toxins
Laboratory-selected strains. Over 500 species of insects
have become resistant to one or multiple synthetic chemical
insecticides (132). In the past it was hoped that insects would
not develop resistance to B. thuringiensis toxins, since B. thuringiensis
and insects have coevolved. Starting in the mid-1980s,
however, a number of insect populations of several different
species with different levels of resistance to B. thuringiensis
crystal proteins were obtained by laboratory selection experiments,
using either laboratory-adapted insects or insects collected
from wild populations (112, 364). The degree of resistance
observed in an insect population is typically expressed as
the resistance ratio (number of LC50-resistant insects/number
of LC50-sensitive insects), and while resistance ratios determined
by different types of bioassay are correlated, they are
known to give different values (293), so that some care is
required in comparing results. Examples of laboratory-selected
insects resistant to individual Cry toxins include the Indianmeal
moth (Plodia interpunctella) (262), the almond moth
(Cadra cautella) (263), the Colorado potato beetle (Leptinotarsa
decemlineata) (406), the cottonwood leaf beetle (C.
scripta) (25), the cabbage looper (T. ni) (106), the cotton leafworm
(Spodoptera littoralis) (276), the beet armyworm (S. exigua)
(272), the tobacco budworm (H. virescens) (145, 210,
362), the European corn borer (O. nubilalis) (41), and the
mosquito Culex quinquefasciatus (133). Instances of resistance
discussed in the text below are summarized in Table 3.
In 1985, McGaughey (262) reported that Indianmeal moth
populations from grain storage bins that had been treated for
1 to 5 months with a B. thuringiensis subsp. kurstaki formulation
had a small but significant increase in LC50s relative to populations
in untreated bins. Laboratory experiments with colonies
collected from treated bins demonstrated measurable increases
in resistance after only two generations of selection.
After 15 generations of selection, insects from the treated
colony showed LC50s nearly 100-fold greater than those shown
by control colonies. The resistance trait proved to be recessive.
When selection was removed before resistance became fixed,
resistance levels decreased (263). A later study determined
that resistance was correlated with a 50-fold decrease in binding
affinity of a receptor for the Cry1Ab protein, one of the
toxins in the B. thuringiensis formulation used for selection
(396). In contrast, this Cry1Ab-resistant population showed an
increased susceptibility to Cry1Ca, a protein not present in the
selective formulation, and a corresponding increase in binding
sites on the midgut for the Cry1Ca protein.
Several additional colonies of P. interpunctella were selected
for resistance to B. thuringiensis strains having, in some cases,
toxin compositions different from the one described above
(264). The LC50s for several toxins were determined for each
colony. While resistance ratios for Cry1Ac and Cry1Ab were
most dramatic (24 to .2,000), resistance ratios of .10 were
also found for Cry1Aa, Cry1Ba, Cry1Ca, and Cry2Aa in some
of the colonies. A high level of resistance to Cry1Ac in three of
the colonies was noteworthy, because the selective B. thuringiensis
strains were reported not to produce that toxin. The
toxin binding characteristics of Cry1Ac to BBMV proteins and
tissue sections of several of these colonies have been studied
(274). Binding to an 80-kDa BBMV protein appeared unaltered
in ligand blots using BBMV from sensitive and several
resistant insect colonies. By contrast, the binding of fluorescein
isothiocyanate-labeled Cry1Ac toxin to midgut cells from insects
selected with Dipel or HD-133 was much reduced compared
to results with sensitive insects. For a P. interpunctella
colony under selection with B. thuringiensis subsp. entomocidus
HD-198, resistance to Cry1Ac was correlated with reduced in
vitro activation of Cry1Ac protoxin by midgut extracts from
resistant larvae (285). Examination of midgut enzymes in protease
activity blots revealed that one of the two major trypsinlike
proteases found in P. interpunctella was missing in the
mutant. A similar result was also observed for a colony resistant
to B. thuringiensis subsp. aizawai HD-133. In genetic
crosses, the protease-deficient and Cry1Ac-resistant phenotypes
cosegregated as a recessive trait (284).
Colonies of H. virescens with different levels of resistance
and different resistance mechanisms have also been obtained
in selection experiments with B. thuringiensis strains and proteins.
In an H. virescens population selected on Cry1Ab protoxin
expressed by an engineered P. fluorescens strain, resistance
to Cry1Ab increased to 20-fold after seven generations.
Resistance further increased to 71-fold after four additional
generations of selection with Dipel, a formulated B. thuringiensis
product containing several crystal proteins, including
Cry1Ab (362). The toxin showed a lower binding affinity to a
higher number of binding sites within the insect gut, but the
change in binding characteristics was considered insufficient to
explain the resistance (240).
Selection of another H. virescens population with Cry1Ac
protoxin as produced by a natural B. thuringiensis strain resulted
in a 50-fold resistance to Cry1Ac, a 13-fold resistance to
Cry1Ab, and a 53-fold resistance to Cry2Aa (145). Larvae from
this population could not survive on transgenic tobacco plants
with moderate (0.01%) levels of Cry1Ab (194). Altered toxin
binding was not implicated as a factor in resistance, an observation
that again suggests the existence of multiple resistance
mechanisms.
Very high levels of resistance to Cry1Ac (over 10,000-fold)
and to Cry1Ab (more than 2,000-fold) were obtained in H.
virescens by selection with Cry1Ac (144). The H. virescens colony
was highly cross-resistant to Cry1Aa and Cry1Fa but displayed
minimal resistance to Cry1Ba and Cry1Ca. A recent
study (146) showing that Cry1Fa and Cry1Ab compete for the
same receptor, at least in P. xylostella, provides a plausible
explanation for this observation. Larvae of this resistant H.
virescens strain survived significantly better than susceptible
larvae (144) on transgenic tobacco plants reported to produce
levels of Cry1Ab up to 0.007% of soluble protein (400). Surprisingly,
the binding of Cry1Ac (the selective toxin) and
Cry1Ab was unchanged while the binding of Cry1Aa was dramatically
reduced (210). It had already been demonstrated that
Cry1Ac also binds to the Cry1Aa binding site in H. virescens
(395). Consequently, it was proposed that the altered Cry1Aa
binding site caused resistance to all three Cry1A toxins and
that the additional binding sites recognized by Cry1Ab and
Cry1Ac might not be involved in toxicity (210). The allele
conferring most of the resistance phenotype of this strain has
been mapped to a 10-centimorgan region on linkage group 9 of
H. virescens at a locus termed BTR4 (155). The initial frequency
of this resistance allele in wild H. virescens populations
in the Southeastern United States was estimated to be between
1 in 500 and 1 in 667 (143), which is consistent with estimates
based on initial populations of insects used in selection experiments
(1 in 200 to 1 in 2,000) (142).
Selection experiments using Cry1Ca have generated resistant
strains of Spodoptera species. An S. littoralis colony with
.500-fold resistance was obtained (276). These insects were
cross-resistant to Cry1Da (7-fold) and Cry1Ea (34-fold). However, their susceptibility to Cry1Fa was unchanged, consistent
with the observation that Cry1Fa and Cry1Ca compete for
different receptors, at least in P. xylostella (146). An analysis of
the inheritance of resistance in this S. littoralis strain indicates
it is partially recessive and probably multifactorial (66). Moar
et al. (272) developed an S. exigua strain resistant to Cry1Ca
toxin. The basis of resistance could not be entirely explained by
changes in toxin binding characteristics. This insect strain was
cross-resistant to Cry1Ab, Cry2Aa, Cry9C, and a Cry1Ea-
Cry1Ca hybrid protein (44).
Given the multiple steps in processing the crystal to an active
toxin (see “Mechanism of Action”), it is not surprising that
insect populations might develop various means of resisting
intoxication. It is important, however, to keep in mind that
selection in the laboratory may be very different from selection
that occurs in the field. Insect populations maintained in the
laboratory presumably have a considerably lower level of genetic
diversity than field populations. Several laboratory experiments
to select for B. thuringiensis resistance in diamondback
moths failed, although the diamondback moth is the only
known insect reported so far to have developed resistance to B.
thuringiensis in the field. It is possible that the genetic diversity
of the starting populations was too narrow and thus did not
include resistance alleles. In the laboratory, insect populations
are genetically isolated; dilution of resistance by mating with
susceptible insects, as observed in field populations, is excluded.
In addition, the natural environment may contain factors
affecting the viability or fecundity of resistant insects,
factors excluded from the controlled environment of the laboratory.
Resistance mechanisms can be associated with certain
fitness costs that can be deleterious under natural conditions
(383). Natural enemies, such as predators and parasites, can
influence the development of resistance to B. thuringiensis by
preferring either the intoxicated, susceptible or the healthy,
resistant insects. In the former case, one would expect an
increase in resistance development, while in the latter, natural
enemies can help to retard resistance development to B. thuringiensis.
Nevertheless, selection experiments in the laboratory
are valuable because they reveal possible resistance mechanisms
and make genetic studies of resistance possible.
Field-selected strains. The first case of field-selected resistance
to B. thuringiensis was reported from Hawaii, where
populations of diamondback moth (P. xylostella) showed different
levels of susceptibility to a formulated B. thuringiensis
product (Dipel). Populations from heavily treated areas
proved more resistant than populations treated at lower levels,
with the highest level of resistance at 30-fold (365). Laboratory
selection rapidly increased resistance to .1,000-fold (366). A
study of the resistance mechanism showed a reduced binding
of the Cry1Ac protein to gut BBMV (365). However, immunohistochemical
(105) and surface plasmon resonance (257)
analyses demonstrated the presence of at least some receptor
molecules on the midgut of this resistant insect strain. The
resistance trait is conferred largely by a single autosomal recessive
locus (367, 368). This “Hawaii” resistance allele simultaneously
confers cross-resistance to Cry1Aa, Cry1Ab, Cry1Ac,
Cry1Fa, and Cry1Ja but not to Cry1Ba, Cry1Bb, Cry1Ca,
Cry1Da, Cry1Ia, or Cry2Aa (369). At least one Cry1A-resistant
diamondback moth strain has been shown to be very susceptible
to Cry9C (198). The toxins in the cross-resistance group
have significant amino acid sequence similarity in domain II, a
region believed to be important for receptor binding in many
systems (see “Mechanism of Action”). Furthermore, Cry1Aa,
Cry1Ac (21), and Cry1F (146), but not Cry1B or Cry1C (113),
compete for the Cry1Ab binding site in P. xylostella, observations
that clearly correspond to the cross-resistance data. A
phenotypically similar resistant strain collected in Pennsylvania
carries a resistance allele at the same multitoxin resistance
locus (368).
A P. xylostella strain collected in Florida showed very high
resistance to a B. thuringiensis subsp. kurstaki formulation and
low-level resistance to B. thuringiensis subsp. aizawai (341).
The strain has been estimated to have .200-fold resistance to
Cry1Aa, Cry1Ab, and Cry1Ac and 60-fold resistance to the
HD-1 spore but near wild-type sensitivity to Cry1B, Cry1C, and
Cry1D. Binding of Cry1Ab, but not Cry1B, was reduced with
midgut tissue sections and native BBMV prepared from the
resistant strain (372). The existence of a single-locus resistance
allele with autosomal, incompletely recessive inheritance best
fits the genetic data for B. thuringiensis var. kurstaki resistance
in this strain (371). A simple and plausible explanation is that
the multitoxin resistance locus altered in the Hawaii and Pennsylvania
strains is also affected in the Florida population, but
this possibility has not been tested. The resistance phenotype
was not associated with any fitness costs and, after an initial
decrease in resistance during the first three generations, remained
stable at a high level even in the absence of selection
(371). Diamondback moth populations with a similar resistance
phenotype—high-level resistance to B. thuringiensis
subsp. kurstaki formulations and low-level resistance to B. thuringiensis
subsp. aizawai—have also been isolated in Indonesia
(341), Malaysia (167), Central America (292), and several
states within the continental United States (341). Data are
insufficient, however, to compare these strains to the resistant
Hawaii, Pennsylvania, or Florida populations in stability, inheritance,
or mechanism of resistance.
A field population of diamondback moths from the Philippines
showed partial resistance to Cry1Aa, Cry1Ab, and
Cry1Ac, but full sensitivity to Cry1C, Cry1F, and Cry1J (368).
Binding to resistant-strain BBMV was reduced for Cry1Ab but
apparently unaffected for Cry1Aa, Cry1Ac, or Cry1C. Interestingly,
the Cry1Ab single-resistance phenotype appeared to be
due to an autosomal, recessive mutation at the multitoxin
resistance locus implicated in the resistant Hawaii and Pennsylvania
strains, although the Philippines allele conferred no
cross-resistance. Inheritance of resistances to Cry1Aa and
Cry1Ac was expressed in an autosomal dominant and semidominant
fashion, respectively, at the test dose employed
(368). Cry1Ab binding was also implicated in the resistance
mechanism of a strain isolated earlier from the same region of
the Philippines (49, 113), although the cross-resistance phenotypes
and inheritance patterns of this earlier isolate were not
rigorously analyzed.
Resistance to B. thuringiensis subsp. kurstaki products and
resulting failure in diamondback moth control has resulted in
extensive use of B. thuringiensis subsp. aizawai-based insecticides
in certain locations. Insects in two colonies from Hawaii
have up to a 20-fold resistance to Cry1Ca compared to several
other colonies, including one obtained earlier from the same
location, as well as moderately high resistance to Cry1Ab and
kurstaki subspecies-based formulations (228). Following additional
selection in the laboratory, Cry1Ca resistance increased
to 60-fold over control levels. The Cry1C resistance trait was
shown to segregate independently from the Cry1Ab resistance
determinant, behaving as an additive autosomal trait, appearing
recessive at high test doses of toxin and dominant at low
test doses (227).
A Malaysian strain simultaneously highly resistant to the
kurstaki subspecies and the aizawai subspecies was apparently
mutated in several loci (418). A Cry1Ab resistance allele, associated
with reduced binding to BBMV receptors, was partially
responsible for resistance to both subspecies. In contrast, binding of Cry1Aa, Cry1Ac, and Cry1C showed no gross alterations
compared with BBMV from the sensitive strain. Genetic
determinants responsible for subspecies kurstaki-specific and
subspecies aizawai-specific resistance segregated separately
from each other and from the Cry1Ab resistance allele in
genetic experiments (418).
These studies suggest that a single locus, perhaps encoding a
common receptor for many of the Cry1A toxins, can mutate to
multitoxin resistance in P. xylostella. A different type of mutation
at the same locus might alter the binding site for Cry1Ab,
while leaving binding sites for other toxins on the same receptor
unaffected. Unlinked loci affecting other events in toxicity,
either before or after the binding step, can mutate to provide
specific resistance to other Cry toxins. Additional studies along
the lines of that conducted by Tabashnik et al. (368), using
other resistant strains, are urgently needed to clarify the genetic
and mechanistic picture.
It is clear, however, that the case history of P. xylostella
presents a cautionary tale for the use of B. thuringiensis and its
toxins in agriculture. After less than 2 decades of intensive
subspecies kurstaki use in crucifer agriculture, resistant insects
have evolved in numerous geographically isolated regions of
the world, and subspecies aizawai resistance is beginning to
appear even more rapidly. Injudicious use of Cry toxins could
rapidly render them ineffective against other major crop pests,
squandering a precious resource at a time when synthetic organic
pesticides are already increasingly ineffective. Various
alleles showing cross-resistance, dominant inheritance, or stability
in the absence of selection have been detected in resistant
field lines of P. xylostella, phenomena with far-reaching
implications for resistance management. These observations
underscore a critical need for increased emphasis and funding
on an international scale for all aspects of Cry toxin research.
Resistance Management
Resistance management strategies try to prevent or diminish
the selection of the rare individuals carrying resistance genes
and hence to keep the frequency of resistance genes sufficiently
low for insect control. Strategy development generally relies
heavily on theoretical assumptions and on computer models
simulating insect population growth under various conditions
(12, 141, 168, 250, 320, 321, 364). Proposed strategies include
the use of multiple toxins (stacking or pyramiding), crop rotation,
high or ultrahigh dosages, and spatial or temporal refugia
(265, 364). Only recently have some of the proposed tactics
been experimentally evaluated on a small scale (342). Retrospective
analysis of resistance development does support the
use of refugia (364). It is clear that the real value of the
different proposed tactics can only be tested in larger-scale
field trials.
It is expected that each pest-crop complex may require a
specific implementation of certain resistance management
strategies that may have to address the use of both B. thuringiensis
sprays and transgenic crops. Experience with transgenic
crops expressing cry genes grown under different agronomic
conditions is essential to define the requirements of resistance
management. It is equally important to design a resistance
management strategy acceptable to everyone involved: technology
suppliers, seed companies, extension workers, crop consultants,
regulators, and, most of all, growers (182).
In transgenic plants, selection pressure could be reduced by
restricting the expression of the crystal protein genes to certain
tissues of the crop (those most susceptible to pest damage) so
that only certain parts of the plant are fully protected, the
remainder providing a form of spatial refuge (but see the
concerns raised in reference 250). It has been proposed that
cotton lines in which cry gene expression is limited to the young
bolls may not suffer dramatic yield loss from Heliothis larvae
feeding on other plant structures, since cotton plants can compensate
for a high degree of pest damage (140). Crystal protein
gene expression could be triggered by the feeding of the insect
itself in a transgenic plant, with resident cry genes controlled by
wound-inducible promoters (291). If plants were to express B.
thuringiensis toxin only in response to specific damage thresholds,
it might provide a mechanism to diminish toxin exposure
to insects. Alternatively, toxin expression could be induced by
the application of a chemical (409). In this way, a farmer would
have the option to have Cry toxin present in the crops only
when insect densities exceed an economic threshold.
Another management option is the rotation of plants or
sprays of a particular B. thuringiensis toxin with those having
another toxin type that binds to a different receptor. This
strategy has potential value when a fitness cost is associated
with resistance. Such fitness costs have been reported in P.
xylostella lines, in which resistant males have lower mating
success than their nonresistant competitors (149). Insects resistant
to one Cry toxin type would be at a disadvantage during
the next growth season when a different toxin type is used,
resulting in a decrease of the frequency of the corresponding
resistance gene. Ideally, reversion to susceptibility for this Cry
toxin type should occur within the growth season. Tabashnik et
al. (365) noticed that revertant diamondback moth populations
responded rapidly to reselection and susceptibility was not fully
restored.
If transgenic plants can express a cry gene at doses high
enough to kill even homozygous resistant insects, that crop will
become a nonhost. While such an ultrahigh dose might be
impractical with a sprayable product due to high cost, incomplete
coverage, toxin breakdown, and plant growth, it may be
possible with toxin-engineered plants, taking into account the
currently attainable levels of Cry expression in planta (169).
For example, a Colorado potato beetle population 100-fold
resistant to a Cry3A-containing B. thuringiensis spray could not
survive on potato plants expressing the same protein (13, 407).
It remains to be seen if a combination of toxins with ultrahigh
expression can overcome all homozygous resistance alleles,
changing the crops into nonhost plants.
A very attractive resistance management tactic is the combination
of a high-dose strategy with the use of refugia (toxinfree
areas). The principle is to express Cry toxins at such a dose
that nearly all heterozygotic carriers of resistance alleles will be
killed. Survivors would most likely mate with the sensitive
insects harbored in the nearby refuge. Consequently, a population
of homozygous resistant insects would be unlikely to
emerge. B. thuringiensis resistance is in fact a recessive trait in
at least some insect species (364); with the high levels of expression
now attainable in planta (e.g., a dose 50-fold higher
than the LC50) (193), and with essentially complete foliar coverage,
it may be reasonable to attain nearly total killing of
heterozygotes. Indeed, Metz et al. (269) demonstrated that F1
larvae from a cross between a susceptible laboratory P. xylostella
colony and a field-resistant colony did not survive on
transgenic broccoli expressing Cry1Ac (341). It has been reported
that the inclusion of refuge plants in cages with transgenic
broccoli plants resulted in slower evolution of resistance
in populations of P. xylostella (342). Supporting evidence also
comes from selection experiments using B. thuringiensis subsp.
aizawai and a diamondback moth population that had evolved
resistance to Cry1Ab and Cry1Ca in the field. In these studies,
a 10% refuge delayed resistance over a nine-generation test
(226). Depending on the crop, refugia may be naturally present  or may need to be created by the planting of nontransgenic
plots. Refugia should be uncontaminated, and there should be
random mating between resistant and nonresistant insects
(141). Refugia that are temporally and spatially contiguous
with the transgenic crop could fulfill these requirements (118).
See the work of Gould (142) for a broader discussion from a
perspective of population dynamics and evolution.
A specific planting strategy that has been recommended to
reduce selection is the use of seed mixtures of toxin-expressing
and toxin-free plants to provide prepackaged refugia. The seed
mix strategy, still controversial, would probably only be effective
for insect species whose larvae move very little between
plants (250, 364) or whose adults acquire a mate visually over
a short distance (320).
Another valuable option for resistance management, in
combination with the use of refugia, is the expression of multiple
Cry proteins in crops or incorporation of multiple proteins
in B. thuringiensis sprays, provided these toxins have different
modes of action (321) with respect to the insect’s
mechanism of resistance. Cry toxins that recognize different
receptors in the same target species could be deployed in this
strategy, since they are less prone to cross-resistance. As noted
above, diamondback moth populations resistant to field applications
of Cry1A-containing B. thuringiensis formulations
showed minimal cross-resistance to other crystal proteins such
as Cry1Ba, Cry1Bb, Cry1Ca, Cry1Da, Cry1Ia, Cry2A, and
Cry9Ca, while they were cross-resistant to Cry1Fa and Cry1Ja
(198, 365, 369, 372). There are several other insect species in
which Cry toxins with different receptor specificities are known
(93, 105, 113, 163, 198, 394, 395). For many insect species,
multiple Cry1A proteins would not be an appropriate choice,
since some of these proteins share binding sites with one another
(94, 106, 395, 413) and even with other toxins of the Cry1
class (97). Yet for other insects, Cry1A proteins have been
shown, at least on ligand blots, to recognize different binding
proteins (211, 385, 386, 388). Additionally, B. thuringiensis Cry
toxins could be combined with other insecticidal proteins. The
multiple-attack strategy assumes that within a population, if
insects homozygous for one resistance gene are rare, then
insects homozygous for multiple resistance genes are extremely
rare. Crops or sprays deploying multiple toxins would still
control even insects homozygous for one or two resistance
genes yet heterozygous for another gene. A critical condition
for the success of this strategy is that each of the insecticides on
its own should have high mortality for susceptible homozygotes
(321). An example is O. nubilalis, in which Cry1Ab and
Cry1Ba, both highly active, bind to different receptors (94). A
strong argument for the utility of multiple-gene pyramiding is
found in the recent results of Georghiou and Wirth (133).
Their field-collected C. quinquefasciatus populations readily
developed resistance in the laboratory to a single B. thuringiensis
subsp. israelensis toxin (Cry11A) but remained remarkably
sensitive when selection was with the full complement of toxins
from this variety.
Due to the urgent need for a more complete understanding
of the parameters of effective resistance management, companies
developing B. thuringiensis biopesticidal sprays and transgenic
plants formed the B. thuringiensis Management Working
Group in 1988 to promote research on the judicious use of B.
thuringiensis products. It is hoped that an increased understanding
of the complex interplay among Cry toxins, their bacterial
hosts, their target organisms, and the ecosystems they
share will allow for the long-term, effective use of Cry toxins
for pest management.
 


biouided
New
New

Hors ligne

Inscrit le: 12 Déc 2008
Messages: 9
Féminin Bélier (21mar-19avr)
Point(s): 9
Moyenne de points: 1,00
MessagePosté le: Lun 15 Déc - 15:59 (2008) Répondre en citant

DNA amplification using Taq DNA polymerase is one of the most widely used techniques in
molecular biology and biotechnology. The aim of this study was to amplify the gene of this enzyme
from a thermophilic bacteria called Thermus aqauticus and clone it into a vector for future use. Using
specific primers the cDNA of Taq DNA polymerase was amplified and ligated into the cloning vector
pTZ57R using TA cloning technique. The recombinant plasmids were identified using restriction
enzyme digestion. The presence of the Taq DNA polymerase gene was confirmed by DNA
sequencing. In conclusion, Taq DNA polymerase gene has been cloned in our laboratory and can be
used for the production of large quantities of this enzyme.
 

INTRODUCTION
Taq DNA Polymerase is an enzyme
obtained from a heat stable bacteria called
Thermus aquaticus having a molecular
weight of about 66,000-94,000 daltons (1).
This enzyme is used for the amplification
of selective DNA segments using polymerase
chain reaction (PCR 2). The Taq DNA
polymerase isolated from thermus aquaticus
was the first characterized thermostable
enzyme and is one of the most widely used
enzymes of this category. This thermostable
enzyme enables the amplification
reaction to be performed at higher temperatures
and makes the automation of PCR
possible (3). The full length 94 kDa Taq
polymerase has maximal activity and half
life of 9 min at 97.5 C (4).
More than 50 DNA polymerase genes
have been cloned and sequenced from
various organisms including thermophiles
and archaea (5). Although some laboratories
have reported the cloning of Taq DNA
polymerase (6), no study has been conducted
in Iran. Because of the economic value of
this enzyme, obtaining this clone from
external sources for laboratory production
of Taq DNA polymerase is extremely
difficult. Therefore, in order to produce
Taq DNA polymerase, reduce the cost of
research in our laboratory, and having the
gene of this enzyme for future modifications,
we decided to amplify and clone Taq
DNA polymerase gene. For this purpose,
TA cloning technique was used, which has
not been utilized by any previous study
reporting cloning of this gene
MATERIALS AND METHODS
Bacterial strains and plasmids
Thermus aquaticus strain YT-1 (ATCC-
25104) a gift from Dr. Kutellu Ulgen (Turky, Bogazici University), was used as
a source to isolate the thermostable Taq
DNA polymerase gene. E. coli XL1-Blue
strain was used as a host for recombinant
plasmids. The plasmid pTZ57R obtained
from Fermentas company was utilized as a
cloning vector.
Growth conditions
E. coli strains were grown at 37 C in
Luria Bertani (LB) broth or plated on LB
agar containing 80 g/ml ampicillin as
described by Sambrook et al. (7).
Genomic DNA preparation
The Genomic DNA from Thermus
aquaticus strain YT-1 was isolated using
high pure PCR template preparation kit,
which was purchased from Roche Co.
(Germany). Electrophoresis in 0.7%
agarose gel was used to confirm the size of
the isolated DNA (7).
Amplification protocol
A pair of primers were designed based
on the 5' and 3' ends of this gene and were
utilized for PCR amplification. The
sequence of these primers were as follows:
Forward: 5′-CACGAATTCGGGGATGCT
GCCCCT CTTTGAGCCCAAG-3′
Reverse: 5′-GTGAGATCTATCACTCCT
TGGCGGAGAGCCAGTC-3′
PCR amplification was performed using
the following reagents: 1 X PCR reaction
buffer (50 mM KCl, 20 mM Tris- HCl (pH
8.4), primers (each 2.5 µM), 3 mM MgCl2,
0.5 mM dNTPs, 0.4 ìg template DNA, 1X
Q solution, 5 Unit Taq polymeras (QIAGEN,
Germany). The final reaction volume was
50 µl. PCR cycles were as follows: one
cycle of 5 min at 94 C, 35 cycles of: l min
at 94 C, 2 min at 55 C, 3 min 72 C, and
one cycle of 20 min at 72 C (8).
Confirmation of PCR product
The amplified PCR product was analyzed
by electrophoresis in 0.7% agarose gel. In
addition to checking its sized, using HindIII
Figure 1. Amplification of the Taq polymerase gene.
Figure 2. Restriction digestion of the PCR product.
restriction enzyme the amplifi-cation of
Taq DNA polymerase gene was confirmed.
Finally, after cloning of this PCR
fragment, its sequencing was carried out
using T7 primer in Fazapajooh Co.
 

Ligation
The PCR product was extracted by QIA
quick gel extraction kit obtained from
Germany. The concentration of the insert
was determined using  DNA (HindIII
digested). This insert was then ligated into
pTZ57R vector using InsT/A clone PCR
product cloning kit (Fermentas, Germany).
Ligation was performed in 10 µl volumes
under the following conditions: The molar
ratio of 3/1 for insert to vector, 1X ligase
buffer, 1X PEG 4000, BSA (0.44 ng), 5
Units T4 DNA ligase (Fermentas), and
dH2O. The reaction mixtures were
incubated over night at 16 ºC.
Transformation and plasmid preparation
The ligated mixture were transformed to
XL1-Blue competent cells (CaCl2 method)
using heat shock method (42 oC, 45 sec).
These mixtures were then plated on LB
agar containing 100 µg/ml ampicillin and
incubated at 37 oC overnight. The obtained
colonies were used for plasmid preparation
(7). Restriction enzymes, EcoRI, BamHI,
KpnI and HindIII were used for the
digestion of these plasmids
RESULTS
The isolated DNA from from Thermus
aquaticus colonies used as a template for
PCR amplification of Taq DNA polymerase
gene. The electrophoresis of this
product is shown in Figure 1 matching the
expected size of the gene which is 2500
bp. Digestion of this DNA with HindIII
restriction enzyme gave the expected
two bands of 1900 bp and 600 bp as is
shown in Figure 2 (Lanes 2 and 3).The
amplified product corresponding to Taq
DNA polymerase gene was ligated into
pTZ57R vector. The presence of the insert
within the plasmid was confirmed by
restriction enzyme digestion. HindIII
enzyme produced two bands (1974 bp and
3400 bp), KpnI enzyme also produced two
bands (617 and 4800 bp), and double
digestion with BamHI and EcoRI enzymes
Figure 3. Restriction analysis of colonies for the presence of
the recombinant plasmids.
 

 

resulted in three bands (719, 1700 and
2900 bp) as shown in Figure 3 (Lane 2, 3
and 4). A segment of the recombinant
plamid was also sequenced (Figure 4).
DISCUSSION
Because of the widespread use of Taq
DNA polymerase, we decided to amplify
and clone its gene. Several attempts
varying the experimental conditions, such
as PCR cycles and MgCl2 concentrations
were made for its amplification without
any success. Surprisingly, by changing the
brand of Taq DNA polymerase, the desired
product was obtained. Considering that
Taq DNA polymerase should act the same
when purchased from any company, our
results indicate that some of the local
companies sell faulty products and one has
to be selective in ordering reagents from
these sources.
Desai and Pfaffle have reported the
cloning of Taq DNA polymerase into
pUC18 plasmid (8). Other reports are also
available regarding the cloning of this gene
(6, 9). However, our study is the first to
clone the Taq DNA polymerase gene using
TA cloning method. This is a more
convenient and much faster procedure as
compared to those used in other studies.
The sequencing of the obtained clone in
our laboratory indicated that for the first
time in Iran, Taq DNA polymerase gene
has been successfully cloned. This would
allow us to perform many studies including
expression of this gene, mass production of
the enzyme and introducing mutations for
enhancing its performance.


Ben
Administrateur
Administrateur

Hors ligne

Inscrit le: 18 Aoû 2007
Messages: 7 763
Masculin
Point(s): 1 879
Moyenne de points: 0,24
MessagePosté le: Lun 15 Déc - 16:20 (2008) Répondre en citant

Mort de Rire , tu es un legionnellogue ?????


Sage
Diamond
Diamond

Hors ligne

Inscrit le: 22 Aoû 2007
Messages: 1 380
Masculin
Point(s): 443
Moyenne de points: 0,32
MessagePosté le: Lun 15 Déc - 17:16 (2008) Répondre en citant

plutôt legionnellophile :lol:

_________________
Il faut que le disciple de la sagesse ait le coeur grand et courageux


sidali
Emerald
Emerald

Hors ligne

Inscrit le: 15 Nov 2008
Messages: 909
Masculin Verseau (20jan-19fev)
Point(s): 963
Moyenne de points: 1,06
MessagePosté le: Mer 24 Déc - 04:31 (2008) Répondre en citant

non!!!!!je crois legianglaiophile happy
quelle sujet!!!il lui a fallu tout une page;je crois que c'est un record scof:le sujet le plus long


eRa
eRa

Hors ligne

Inscrit le: 23 Aoû 2007
Messages: 1 685
Localisation: marrakech
Féminin Scorpion (23oct-21nov) 蛇 Serpent
Point(s): 518
Moyenne de points: 0,31
MessagePosté le: Jeu 8 Jan - 17:14 (2009) Répondre en citant

Je voulais faire quote, m'ai j'avais peur de xooit qu'il me chasse

_________________


MSN
Visiter le site web du posteur
Contenu Sponsorisé





MessagePosté le: Aujourd’hui à 18:29 (2016)

Montrer les messages depuis:   
  Poster un nouveau sujet   Répondre au sujet medmatiq Index du Forum » Médecine » 2èm cycle " 3 , 4 et 5 ème année " » Microbiologie - Maladies infectieuses
    

    

  
 

Portail | Index | creer un forum | Forum gratuit d’entraide | Annuaire des forums gratuits | Signaler une violation | Conditions générales d'utilisation



Medmatiq © 2007
Forums amis : MedMar- carrefour-dentaire
skin developed by: John Olson
Powered by phpBB © 2001, 2005 phpBB Group
Traduction par : phpBB-fr.com